The system of Assessing for Elementary School Essay

The system of Assessing for Elementary School - Essay Example This was treated as a successful method to make them enjoy the essence of the classroom. One more thing is that children are attracted towards colors, so they take special attention in listening, and even those who do not pay attention will try to concentrate a little than what they had been doing before.Recommendations for the pictographic test:1. It should be noted particularly that a classroom is composed of all levels of students starting from dull to brilliant students, so any system, for instance, should be implemented with the notion to improve the quality of learning of all levels of students. In the case of dull students, the standard of understanding and remembering becomes quiet doubtful.Because not all the dull students will have benefits from this method. 2. The teacher should concentrate more on the performance of dull students than those who show considerable improvement.3. The choice of colors could be more of a bright nature.4. When the teacher asks the question in t erms of showing a picture and guessing, he or she should come voluntarily and help the students till they get accustomed to this method.5. This method could also be applied while conducting tests for higher class students but they should be given a partial picture so as to enhance their reasoning power and ideas.6. Finally, if a student fails even in this method the teacher should find out the spot where the student has the difficulty. Because while analyzing this test method it is comparatively an easy one to understand the lessons.

Compare and Contrast Army Ground Fleet Maintenance with Civilian Research Paper

Compare and Contrast Army Ground Fleet Maintenance with Civilian Ground Fleet Maintenance - Research Paper Example Civilian institutions conduct business with the aim of profit making while US Army is a non-profit generating government function. This causes both similarities and differences in terms of activities performed in their respective fleet management systems. Below is a comparison and contrast between the two institutions. There is a couple of differences between the U.S. Army Ground Fleet Maintenance activities and the Civilian Ground Fleet Maintenance activities of organizations such as Coca Cola, Pepsi, etc. Some of these differences stem from a legal perspective while others stem from operation activities undertaken in the military bases. Some of the notable differences include; the military outsources its fleet management function to the industry including even tactical vehicles used by the military. For instance, the military in made a decision to outsource its fleet of M109 vehicles family (Paladin) that encompasses the M109 self-propelled howitzer & the M992 field vehicles supplying artillery ammunition under the fleet management program (NDIA Staff, 1999). Further, under the same program, the manager is responsible all resources of technical nature ranging from field maintenance to training hence making him responsible for the entire spare parts modernization, while soldiers control the daily maintenance activities. On the other hand, in the Civilian Ground Fleet Maintenance activities, outsourcing of the fleet management program is restricted to the organizations’ departments mandated to control and manage the company fleets, especially the transport department. For instance, unlike in the military where the function of outsourcing of maintenance services is a policy, in Civilian organization outsourcing of the maintenance activities is done in-house by the organizations workers e.g. in the case of Coca-Cola. Therefore, unlike in the military, Ground Fleet Maintenance activities are accomplished

Characterisation of Prostate Cancer Stem Cells

Characterisation of Prostate Cancer Stem Cells Abstract Background Advances in the study of cancer cells with stem cell characteristics may enable the development of new and improved cancer therapies. Stem cell marker expression can be investigated by QPCR and this sensitive method has been used to characterise prostate cancer stem cells. Methods Prostate cancer cell lines LNCaP and C42B were grown under adherent and nonadherent culture conditions. Non-adherent culture generated prostaspheres that are enriched in stem cells. In addition, LNCaP and C42B prostaspheres were treated with Wnt3a. RNA was extracted from both adherent and prostasphere cultures of LNCaP and C42B cells. cDNA was synthesized and QPCR analysis was performed with TaqMan probes in order to examine the expression of 10 genes: Nestin, Oct4, Sca-1, BMI-1, PSA, NSE,CD44, K18, ABCG2 and c-kit. Results Prostasphere culture caused a dramatic increase in the relative expression of ABCG2 and Keratin 18 in both cell types. Conclusion The findings suggest ABCG2 may be a valuable marker for identification of prostate cancer cells with stem cell characteristics. Moreover this technique of Q-PCR may prove to be a sensitive method of evaluating markers in cancer patients. Introduction Prostate cancer is commonly diagnosed in males over 60 and is the second most common cause of cancer death in UK in men, after lung cancer (1). Following diagnosis, prostate cancer is categorised in low risk, intermediate risk and high risk. For low risk cases treatment is usually under active surveillance while intermediate and high risk is treated by surgery and radiation. Advanced cases (presence of metastasis) treatment is by androgen ablation and it almost always produces objective clinical responses (2). However, in most patients there is relapse with the development of androgen independent prostate cancer, which is associated with a median survival, of 20–24 months (3). Currently, androgen independent metastatic prostate cancer is treated by Docetaxel an anti-mitotic that extends life by an average of 3 months (3). Although, the mechanisms of prostate cancer development and progression have been extensively studied this process is not fully understood. Several genes including MYC and PTEN have been linked to the development of prostate cancer (28). However, one of the most important discoveries in the genetics of prostate cancer is the identification of TMPRSS2-ETS fusion protein that arises as a result of a genetic translocation (4). TMPRSS2 is androgen-regulated transmembrane serine proteases secreted by normal prostatic tissue and an increase in androgen level increases TMPRSS2 expression. ETS family transcription factor (ERG, ETV1, or ETV4) targets genes involved in cell transformation, growth and apoptosis. Therefore fusion of TMPRSS2 gene promoter with one of the member of ETS family results in positive dysregulation of the ETS gene. TMPRSS2-ETS fusion proteins have been speculated to play a role in the development of up to 50% of prostate cancers but not the progression to androgen independence (4). Androgen independent prostate cancer has been postulated to arise as a consequence of increase activity of the androgen receptor (AR), altered cell signalling pathways, or the survival and proliferation of prostate cancer stem cells. Recent papers have conceptualized that cancer can arise from cancer cells with the characteristics of stem cells, unlimited self-renewal and the ability to produce differentiated daughter cells (5). These cells have been termed cancer stem cells (10) and may promote tumour growth, metastasis and relapses, thus having a huge impact on patient survival. The cancer stem cell model hypothesis is that cells with stem cell characteristics accumulate genetic changes over long period of time, escape the environmental control and give rise to cancerous growth. There is good evidence that cancer stem cells cause leukaemias and it has also reported that cancer stem cells can contribute to solid tumour development in brain, breast, colon and prostate. As prostate cancer is a heterogenic disease, several distinct cancer stem cell populations maybe present in a tumour (5). On basis of this knowledge, the role of cancer stem cell is been explored in solid tumours. For instance in prostate cancer mutation of the androgen receptor may result in the growth of tumour that can sustain androgen deprivation or very low level of androgen or use alternative pathways involving growth factors and cytokines. Recent studies (6) have also identified mammary stem cells as being a potential source of breast cancer, tumour relapse and tumour metastasis. For this reason it is vital to understand the stages of cell differentiation in normal prostate epithelium and identification of cells that are involved in prostate carcinogenesis and androgen independent prostate cancer. The prostate is a glandular organ comprising of three distinct epithelial cell populations that may contribute to tumorigenesis (7). Each prostatic duct is lined by nonsecretory basal cells which form a layer along the basement membrane (figure 1). Luminal cells are the major secretory cell, producing 30% of seminal fluid components and lining the lumen of duct and acini. These luminal cells are highly differentiated and expresses prostate specific antigen, cytokeratin 8 and 18 and the nuclear androgen receptor (27). Neuroendocrine cells are also present along the basement membrane and secrete neuroendocrine peptides that support epithelial growth and viability. Vascular components and stromal endothelial cells are also present in the gland. Figure 1. Schematic presentation of the cell types within a human prostatic duct. (Adapted from Abate-Shen, C. Shen, M et al 2000) Recent evidence has suggested stem cells are also present within the prostate cancer cell population. It have been theorized that stem cells may lie in the basal layer of prostate in man and in the basal and luminal compartments in mice (19). A transient amplifying population of daughter cells arises from these stem cells and generates differentiated PSA producing cells in man. Stem cells can have different characteristics, including resistance to apoptosis and increased expression of multidrug resistant transporters (8, 23, 24, 25 ). The findings of Collins et al 2001 (9) revealed that stem cells can be distinguished from the transient amplifying cells and showed there is 2-3 fold increases in expression of surface level of integrin ÃŽ ±2ÃŽ ²1. Figure 2. Hypothetical model of stem cells showing normal prostate development and prostate cancer (De Marzo MA et al 1998). De Marzo MA et al 1998 in his paper states pluripotent stem cells are capable of differentiation and self-renewal and is present in the basal epithelium of the prostate, which contains cytokeratin 5 and 14 expressing cells (figure 2). Intermediate progenitor populations located within the basal epithelium expresses both basal and secretory cell characteristics (11). Intermediate cells with limited proliferative capacity can differentiate into mature secretory luminal (androgen receptor positive) or neuroendocrine cells which are non-proliferative. In prostate cancer, it is proposed that transformation occurs which leads to the proliferation of cells with stem cell characteristics and the production of an excess of cells with luminal characteristics (Bisson and Prowse 2009). Normal murine prostate stem cells have been functionally identified by their ability to form prostate spheres (13) and to form differentiated prostate tubular structures when returned to an in vivo environment (13, 14). The in vivo generation of prostate structures from normal human prostate cells in xenograft studies and the ability to isolate a human basal prostate cell population with enriched capacity for prolonged clonal expansion and luminal differentiation have led to the hypothesis that normal human prostate stem cells are located within the basal layer of the gland (15-18). English HF et al 1987 (19) in an experiment found following androgen ablation of rodent prostate glands the stem cells exhibited regenerative properties especially of the secretory cells indicating these cells are self- sustainable, which supports the hypothesis that stem cells reside within the basal layer of the gland and are able to survive in absence of androgen environment. These cells may also therefore have the ability to survive androgen deprivation therapy and contribute to the development of metastatic prostate cancer. At present proper characterization of stem cells has been limited by the absence of specific markers that distinguishes stem cells from their more differentiated progeny. Gene expression and microarray profiling may be able to identify specific markers. These markers may also be prognostic for patient response to therapy and survival. Past papers have discussed non-adherent culture media techniques to isolate neuronal, colon and breast cancer cells that exhibited stem cell characteristics. In a recent paper by Bisson and Prowse et al 2009 (10) the authors studied prostate cancer cell lines (22RV1, DU145, PC3, VCaP, LNCaP and the LNCaP subline C4-2B) and were able to form prostosphere in non adherent culture conditions. Prostosphere were able to form from both AR positive (LNCaP, VCaP, 22RV1) and AR negative (PC-3, DU145) cell lines. Analysis of marker protein expression of proliferation (ki67) and differentiation (keratin 18 and PSA) of prostosphere revealed that cell heterogenecity existed within the prostaspheres, which may be due to different percentages of stem cells within the cell lines or maybe related to adaptation to their environment in the nonadherent culture conditions. Immunoflourescence (Figure 4) of these prostospheres with stem cells associated markers (CD44, CD133, ABCG2) showed increase in expression compared with the adherent cultures, consistent with enrichment for stem cells. However this analysis was only performed by immunofluorescence, and was limited by the semi-quantifiable nature of this technique and the antibodies available (10). Aim Quantitative analysis of cells with stem like characteristics in prostate cancer has not been attempted yet. The aim of my project is therefore, quantitative PCR (QPCR) analysis of stem cells associated gene expression of the prostosphere compared to that of the adherent culture. Material and Methods For my project I used the prostate cancer cell lines DU145, LNCaP and the LNCaP subline C4-2B. The prostasphere formation (P0) is highest in the cell types of LNCaP and its androgen independent derivative C42B, which both express AR and PSA (23). I conducted my experiments by real time PCR to measure the mRNA level of expression on cDNA extracted from prostasphere of LNCaP and subline of LNCaP, C42B cell line. This assay is both qualitative and quantitative and allowed me to compare the RNA gene expression in relation to the control (GAPDH). However there are certain limitations of using this method in my experiment. The prostasphere is heterogenic and the stem cell population within probably only a small fraction of the cells. Therefore it will be interesting to see how this affects the gene expression of the mRNAs. Cell Culture Prostate cancer cell lines LNCaP, C42B and DU145 were cultured at 37 °C in RPMI using 10% fetal bovine serum (Invitrogen), 2.4 mM glutamine (Sigma-Aldrich), 1% (v/v) pyruvate (Sigma-Aldrich), penicillin and streptomycin (50 U and 50 ÃŽ ¼g/ml) (Invitrogen). Trypsin (Sigma-Aldrich) was used to detach adherent cells, prior to cell counting, passage or analysis (10). Prostasphere cultures were established on low attachment 6-well plate (Costar) when single cells were plated in DMEM/F12 (Invitrogen) supplemented with B27 and N2 (Invitrogen) and grown under these conditions for 6-12 days (Bisson and Prowse 2009). These proliferating spheres of cells are enriched for stem cells (Bisson and Prowse 2009) and were prepared for these experiments by Dr Prowse. The prostasphere medium was also supplemented with WNT3a at 20 µg/ml (RD Systems) and the Hedgehog pathway inhibitor cyclopamine for 6 days prior to analysis. RNA Extraction RNA was extracted from prostate cancer cell lines LNCaP, C42B and DU145 cells (stored at -70 °C and thawed at 37 °c before extraction) using RNeasy Kit (Superscript II enzyme and Poly-A primer) from Qiagen. 600 µl of RLT Plus (10 µl of ÃŽ ²-mercaptoethanol was added to 1ml of RLT Plus buffer prior to the experiment) was added to the cells. The lysate was then added to the QIAshredder spin column sitting on a 2ml eppendorf and centrifuged for 2 minutes at maximum speed (14000 x g). The flow through was transferred to another tube and an equal volume of 70% ethanol was added and mixed by pipetting several times. 700 µl of the samples was added to a RNeasy spin column and centrifuged for 15 secs for 14000 x g. The flow through was discarded and 700  µl of buffer RW1 (supplied) was added to the spin columns and centrifuged for 15 secs at 14000 x g. The flow through was discarded and the column was placed on a new collection tube. 500  µl of buffer RPE was added to the column and centrifuged for 2 minutes to dry the RNeasy membrane. To further dry the membrane the column was placed on another tube and centrifuged at maximum speed for one minute to completely dry the column and to remove the trace of RPE buffer. The column was then transferred to another collection tube and 30  µl of RNAse free water was added. Finally the tube was centrifuged for one minute (14000 x g) and the elute collected. The RNA was stored at -80 °C freezer (detailed protocol attached in Appendix). Reverse transcription c-DNA synthesis was done by using SuperscriptTM III First-Strand Synthesis System for RT-PCR. According to the manufacturer’s instruction 2  µl (2  µg) of previously prepared RNA was added to 1 µl of 50uM oligo (dT)20, 1 µl of 10mM dNTP mix in a tube and DEPC-treated water added to make a volume of 10  µl. The reaction tube was incubated at 65 °C for 5 mins and then placed on ice for one min. In another tube 2  µl of 10X RT buffer, 4 µl of 25mM Mgcl2, 2  µl of 0.1DTT, 1  µl of RNaseOUTTM (40U/  µl) and 1  µl of SuperScriptTM III RT (200 U/  µl) was added. The 10  µl mix of the first tube was added to the second tube and incubated for 50 mins at 50 °C. The reaction was terminated by incubating at 85 °C for 5mins and then chilled on ice. 1  µl of RNase H was added to the tube and incubated for 20 mins at 37 °C. The total yield of cDNA was 25  µl and this was stored at -20 °C till further use. Polymerase Chain reaction Polymerase chain reaction was carried out on the cDNA synthesized, using GREX-f* primer GAGTACCTCTGGAGGACAGA and GRINTRON-r* primer ATGCCATTCTTAAGAAACAGGA. For each reaction 5  µl of 10xPCR buffer II, 3 or 6  µl of 25mM MgCl2, 4  µl of 10mM dNTP, 1  µl of forward and reverse primer at 10  µM and 0.25  µl of AmpliTaq Gold Enzyme were mixed in a tube. cDNA at 10 ng/ µl was added to the reaction tube and made upto 50 ul with deionised water. The reaction was run at 94 °C for 6 min, and then 35 cycles of 94 °C for 30 secs, 55 °C for 30 secs, 68 °C for 30 secs, 72 °C for 30 secs followed by 72 °C for 6 mins. Gel Electrophoresis In order to see the purity of the cDNA synthesized (not contaminated with genomic DNA) gel electrophoresis was carried out. 2% Agarose Gel was prepared with TBE and cyber red added as a fluorescent tag. The gel was poured on a gel plate and a comb was inserted and ran for 30mins at 90V. Relative Quantitative PCR In real-time quantification technology the TaqMan MGB probes contain: †¢ A reporter dye (6-FAM) linked to the 5 ´ end of the probe. †¢ A minor groove binder (MGB) that increases the melting temperature (Tm) without increasing probe length (Afonina et al., 1997; Kutyavin et al., 1997); it also allow the design of shorter probes. A nonfluorescent quencher (NFQ) at the 3 ´ end of the probe 5 ´ Nuclease Assay Process A TaqMan probe contains a reporter dye at the 5 ´ end and a quencher dye at the 3 ´ end of the probe. The DNA polymerase cleaves the TaqMan probe during PCR and separates the reporter dye and quencher dye. This cleavage results in increased fluorescence of the reporter dye (26). Figure 3.TaqMan ® probes require a pair of PCR primers in addition to a probe with both a reporter and a quencher dye attached. When the probe is cleaved, the reporter dye is released and generates a fluorescent signal (Invitrogen). The reporter dye does not fluoresce if the probe is intact. During PCR, if the target of interest is present, the probe specifically anneals between the forward and reverse primer sites. On the other hand if the probe hybridizes to the target the DNA polymerase cleaves the probes between the reporter and quencher. The fragmented probes then separate from the target of interest and further polymerisation of the strand continues (26). For quantification of the change in expression of mRNA the ABI 7500 was used to perform the thermal cycling, data collection and data analysis. In a MicroAmp 96 well plate (Applied Biosystem) 10  µl of final volume of TaqMan mix was placed. The mixture included 5 µl of TaqMan Gene Expression Assay, 0.5  µl of the primer, 0.5  µl of GAPDH (endogenous Control) and 4  µl of 1:3 diluted samples. Prior to this study Ct value (cycle threshold) with a standard curve (Fig 5) was constructed and the primer and GAPDH concentration were determined by optimisation studies. All the primers were purchased from applied biosystem and are listed in Table 1. Using the ABI 7500 system the PCR was carried out at 50 °C for 2 min, followed by 95 °C for 10 mins. Then 40 cycles of 95 °C for 15 secs and 60 °C for 60 secs were performed. Mean relative quantification (RQ) was evaluated using the à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct method using GAPDH as endogenous control. Prior to analysis the PCR products were run on a 2% agarose gel to confirm that the templates have amplified along with GAPDH as endogenous control (figure 5). DATA Analysis The data generated from the RT-PCR were analysed using the recommended threshold by Applied Biosystem and then exported in Excel format. For calibration and generation of standard curves several cDNA cell lines were used: cDNA from DU145, LNCaP and C42B. The slope of the standard curve was calculated from the log input of cDNA in ng/ µl versus the corresponding Ct value. Basic statistical analysis was performed in Excel. Results Cell Culture Dr Prowse used a non adherent technique suspension culture and identified a group of cells within the prostate cell lines 22RV1, DU145, PC3, VCaP, LNCaP and C42B that had the ability to form prostasphere (Figure 4a). Furthermore using the clonal growth assay, each prostasphere was able to grow a further 1-3 prostaspheres (5b) when dissociated to single cells (10). These prostasphere along with prostate cell lines were used in this study. Immunoflourescence conducted by Dr Prowse on the prostate cancer spheres derived from single cells are illustrated in Figure 4A. Figure 4. Representation of prostasphere formation, culture and the effect of Wnt3a on Keratin 18, CD44 and ABCG2. A) Prostasphere shows self renewal and proliferation and this is a schematic representation of this process. B) Prostasphere formation with 0.1% DU145, 8% LNCaP and 8% of C42B cell lines. C) Effect of Wnt3a on keratin 18, CD44 and ABCG2 (Bisson and Prowse et al 2009). RNA extraction and RT—PCR Upon RNA extraction of the cells lines and prostospheres the concentrations were measured by spectrophotometer. It was 234ng/ µl for C42B and 190ng/ µl for DU145 respectively. A PCR was conducted with glucocorticoid receptor gene intron primers and gel electrophoresis was carried out to verify the purity of the samples. Only genomic cDNA of LNCaP and Hela cells amplified under 3 mMMg++ conditions (Figure 5). Figure 5. A) Results of quantitative RT-PCR analysis. The PCR in Lanes 1-5 contained 1.5mM Mg++ and lanes 6-10 contained 3mM Mg++. (B) A 2% gel was run with the PCR products that were amplified in Real Time PCR. Lane 1 represented BMI-1, lane 2 NSE, lane 3 ABCG2, lane 4 Nestin, lane 5 K18, lane 6 CD44, lane 7 OCT4, lane 8 PSA, lane and lane 9 sca-1.In all the lanes except lane 8 a double band was observed. The two bands represented GAPDH and the gene of interest. For construction of a standard curve, serial dilutions (1ng/  µl, 5ng/ µl, 20ng/  µl and 50ng/  µl) of cDNA were used. In all cases, there was a strong linear correlation between the number of thermal cycles required to generate a significant fluorescent signal above background and the log of the input cDNA amount (correlation coefficient ≠¥ 0.90) (Figure 6). The Ct value was against the log of the initial template amount and subjected to linear regression analysis. Figure 6. Real time RT-PCR: standard curves for cDNA obtained from LNCaP, C42B and DU145 cell lines at 1ng/ µl, 5  µl, 20  µl and 50  µl . A strong linear correlation between the CT values and the log of the input cDNA amount (correlation coefficients ranging from 0.97 to 1.0) were obtained. Quantification and Comparison of the Real Time Quantitative RTPCR results between Adherent cells untreated Prostasphere and treated Prostasphere. Delta Ct values for adherent cells and their correlation with those for prostasphere treated and untreated samples showed high correlation (r 2 ≠¥90) emerged for all of the tested genes ( Figure 6). GAPDH was used as endogenous control. In order to quantify the gene expression of the prostasphere and treated prostasphere (wnt3a and cyclopamine) to adherent cells (C42B and LNCaP), 10 markers were compared by Q-PCR using GAPDH as endogenous control (Fig 8). The PCR products were resolved on a 2% gel to confirm the templates have amplified along with GAPDH as endogenous control (Figure 5). Duplex product was seen in most of the lanes. The method of calculation was by à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct method. This method calculates the fold change in respect to the normalized gene. In our study we have compared the fold changes of gene expression of the treated and non treated prostosphere relative to the cell line (C42B and LNCaP). In the table (Table 2) we calculated delta delta Ct in relation to the cell line. Each of the samples were run in triplicates, therefore an average of those three were taken in each cases. For example for C42B spheres, the Ct values are 30.19, 29.92, and 30.27. The average of this was taken (30.19, 29.92, 30.27)/3 which is 30.13 and the same was calculated for GAPDH which is 18.94. In each case that is sphere, C42B wnt3a treated, C42B control (dissolved in DMSO) and spheres treated with cyclopamine the average Ct was calculated. Table 2. Example of calculation for quantification of gene expression in fold changes. Sample Average Ct a of samples b Average Ct of GAPDH à ¢Ã‹â€ Ã¢â‚¬  Ct à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct RQ Values d Prostasphere 30.13 18.94 11.19 -2.01 4.04 Prostasphere +Wnt3a 31.20 19.75 11.46 -1.74 3.34 Prostasphere control 33.97 22.7 11.27 -1.93 3.82 Prostasphere+ cyclopamine 30.28 19.43 10.9 -2.35 5.09 Adherent Cells c 13.20 0 1 a.Cycle threshold. b.Prostasphere, Prostasphere+wnt3a, Prostasphere control, Prostasphere +cyclopamine. c. For adherent cells the à ¢Ã‹â€ Ã¢â‚¬  Ct value was calculated from the standard curve. d. Relative quantification or fold changes. à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct was calculated by subtracting the Ct of the endogenous control (GAPDH) from the Cts of the gene of interest eg 30.31-18.94=11.19. Fold changes are calculated relative to the adherent cells. Therefore à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct is calculated by subtracting the à ¢Ã‹â€ Ã¢â‚¬  Ct value of the adherent cells from the à ¢Ã‹â€ Ã¢â‚¬  Ct of the sample i.e.11.19-13.20=-2.01. Relative quantification (RQ) value of gene expression was calculated by the use of the equation RQ= 2-à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct RQ=2-(-2.01) Therefore an RQ or fold change relative to the adherent cells is 4.04. Figure 7. Q-PCR analysis of the mRNA levels of Nestin, Sca-1, Oct4, BMI-1, NSE, K18, PSA, CD44, ABCG2 and c-kit. Expressions of the markers were calculated by employing the ΔΔCt method. (A) Nestin expression was decreased in prostaspheres in C42B adherent cell, prostasphere treated and untreated and were insignificant. (B). Effect of Sca-1 on C42B was unchanged between adherent cells and the prostaspheres. However in LNCaP a modest increase was observed. (C) The prostasphere expressed nearly two fold increase in expression. (D) Oct4 expressed about four fold increase in prostasphere treated samples (Wnt3a and cyclopamine). (E) In LNCaP Oct4 expression is reduced in Wnt 3a treated prostasphere. (F) In C42B prostasphere and Wnt3a treated prostasphere BMI-1 showed slight increase in level of expression. (G) However this change is not as pronounced in LNCaP. (H) NSE marker shows very high expression for C42B prostosphere control and marked reduction when treated with cyclopamine. (I) In LNCaP, no such change was observed between Prostasphere and Wnt3a treated prostasphere. (J and K) Keratin 18 shows extremely high levels in prostasphere with reduction when treated with Wnt3a or cyclopamine. (L and M) PSA failed to show significant changes in the level of expression. Although wnt3a and cyclopamine treated samples showed slight reduction. (N and O) CD44 was not expressed in both C42B and LNCaP prostosphere. However the adherent cells had high expression of the marker. (P) ABCG2 shows high expression of prostasphere in C42B. Wnt3a treated spheres showed reduced levels. (Q) In case of LNCaP extreme level of expression of ABCG2 was observed in prostosphere. (R) c-kit/CD117 was expressed more in the prostasphere with reduced expression on the Wnt3a treated and cyclopamine treated samples. Nestin and CD44 showed significant reduction in expression compared to the adherent cells of C42B. Nestin expressed less than 1% in prostasphere (figure 8A,) and negligible expression of CD44 (figure 7N) in C42B. There is increase in expression of SCA-1, OCT4, BMI-1, K18, ABCG2 and C-KIT (Figure 7 B, C, F, J, K, p, Q and R). NSE showed significant increase (Figure 7 H) in prostasphere control (97% more expression than adherent cells) and 100% increase in expression of K18 prostasphere(Figure J and K) and 100% increase expression of ABCG2 in prostasphere, prostasphere treated with cyclopamine treated and control. Interestingly Wnt3a treated prostasphere showed reduced expression of ABCG2 (Figure 7 P and Q). In LNCaP expression of CD44 is insignificant (0.01%) and PSA expression is reduced by 40% (Figure O and M). In case of LNCaP there was 18% increase in expression of SCA-1, 16% of BMI-1, 50% in NSE, 100% in case of Keratin 18 (Figure 7 C, G, I, and K). A summary of the results are shown in table 3. Table 3. Comparison of fold changes in mRNA expression in 10 selected genes determined by real-time quantitative polymerase chain reaction (RT-qPCR). Discussion Collins et al 2005 (41) in their paper states tumour cells are organised as hierarchy that are responsible for the formation of cancer. They have been able to identify and characterise cancer cell population from prostate tumours that have the ability of cell renewal and regenerate expressing differentiated cell products. Various studies have developed non-adherent sphere culture to characterise cancer cells with stem cell like characteristics. In vitro culture in unattached conditions where cells grow in round balls called spheres is routinely used for enrichment and propagation of stem cells (40). Prostate cancer is a heterogenous disease and to study the prostate cancer cells with stem cell characteristics prostasphere were cultured by Dr Prowse. Previous papers have established stem cell markers namely CD44+, CD133, ABCG2, ÃŽ ±2ÃŽ ²1 integrin, Sca-1 and ÃŽ ²-catenin and PSA can be utilized to identify stem cell population in normal prostate (29,30).However the role of CD117 is yet to be defined in human. Figure 8. The self renewal capacity of cells with stem cell characteristics and the proliferation/differentiation of transit amplifying cells are regulated by WNT signalling. In addition AR activity is the driving force behind proliferation and differentiation of the transit amplifying cell. ÃŽ ²-catenin which is also an effector of WNT signaling can interact with the activity of AR (Bisson and Prowse et al 2009). In the paper by Bisson and Prowse (10), the authors provide evidence that in absence of AR, WNT activity can control the cell renewal capacity of the prostate cancer cells with stem cell characteristics. On basis of their conclusion they suggested a model (figure 2) where the balance of WNT and AR activity not only regulates the self renewal of prostate cancer cells with stem cell characteristics but also the proliferation and or differentiation of the transit amplifying cells. In my study I tried to characterise the stem cell population within the prostate using different stem cell and differentiation markers and measuring their relative gene expression. This evidence can be used to further charaterise tumour stem cells: as they may comprise only a fraction of the cells responsible for the tumour, and have the abilities of self renewal, proliferation and differentiation. Nestin a neuronal marker, is an intermediate filament protein that identifies progenitor cells in adult tissues. Previous papers (31) have provided evidence of detectable levels of Nestin mRNA and these levels were increased in case androgen-insensitive prostate cancer cell lines (DU145). They were undetectable in the androgen dependent cell line LNCaP. While in C42B, Nestin was expressed only in the adherent cells (Fig 8a). Embryonic stem cell marker such as Sca-1 are used to enrich properties such as, replication quiescence, androgen independence, multilineage differentiation and is capable of promoting regenerative capacity of prostate; in short characteristics of stem cells. In consistent with recent reports (32) our study indicated LNCaP cells grown in anchorage independent conditions showed increase in expression of Sca-1 (Figure 8c). Similarly Oct-4 responsible for stem cell self-renewal (33, 34) showed increase expression in C42B prostasphere (figure 8d). NSE is one of the prognostic indicators of aggressive androgen-independent prostate disease. Neuroendocrine cells provide growth and survival signals to surrounding tumour cells and thereby results in an increase in stem cell population (35, 38, 39). Gene expression is significantly increased in LNCaP prostasphere (Figue 8i). This maybe due to acquisition of the neuroendocrine characteristics by LNCaP in response to long-term androgen ablation therapy (35) or the selective differentiation of prostate cancer stem cells into neuroendcrine cells by non-adherent culture. A recent paper (10) investigated the role of WNT on the size and the self renewal capacity of the prostasphere. The authors noted a significant increase of keratin 18 and CD44 expression with the addition of Wnt3a. This increase in expression was detected in adherent and non adherent cultures with LNCaP prostasphere exhibiting slightly higher level than C42B. CD44 is an important marker with a distinct role in migration and signalling and is present in both stem and differentiating cell population. Evidences have been provided that show CD44 to be present in tumour–initiating cells (36, 37). Therefore it is probable the CD44 would exhibit high exp

County Community College Should Provide On-Campus Housing Essay

When I moved to California two weeks before school started, I had difficulty looking for places to live around County Community College. This is because community colleges don’t usually have on-campus housing facilities for students. This made life very difficult for me because I was brand new to the area and I knew no one. My dad did help me by calling up one of his friends and asked if I could stay at their house temporarily until I was able to find a place I could live at, that was near school because I didn’t have a car at the time. The day I finally found a place to live, school was almost about to start. When I went to check the house out, I really disliked it there because there was no cooking allowed, the only time I could use the stove was to boil water. There were even curfews enforced because poor wooden floorboards would alert everyone whenever someone would walk around just to grab a cup of water or a snack at night. Another limitation was that the landlad y had ridiculous shower curfews that I had to follow. The house was very unclean and unhygienic due to the lack of maintenance and care provided for the building. There was no other choice but to live there because it was the closest place to school, that was within walking or biking distance, I could find because I didn’t know how to take the bus in this new country. This is what leads me to believe that County Community College should see if it’s feasible to construct an on-campus housing facility for students because it is able to help a large variety of students in various ways. County Community is a college that is known for its successful transfer rates. An article on CNN Money discussed about County Community’s fine transferring rates, â€Å"County Community s... ...enefits that can affect current and future students. However, County Community may choose to overlook some obstacles due to the great convenience and the great benefits that it may provide for both staff and students. County Community should not disregard this great opportunity that may change lives for staff and students, but look further more into this. Works Cited Aquije, Omar. â€Å"Most Community Colleges say Building Dorms is Good Plan.† Glens Falls Post-Star, 13 August. 2011. Web. 7 Nov 2013. Clark, Kim. â€Å"Community College: How to Avoid ‘dropout factories.’† Cable News Network, 07 June. 2012. Web. 7 Nov 2013. Driscoll, Emily. â€Å"Great Housing Debate: Living On or Off Campus.† Fox Business. Fox News Network, 19 July. 2013. Web. 7 Nov 2013. Staff, CB. â€Å"Campus Living: On Campus Vs. Off Campus.† College Bound Network, 08 August. 2011. Web. 7 Nov 2013.

Employee Grievances Essay

In industrial context the word grievance is used in industrial context to designate claims by workers of a Trade Union concerning their individual or collective rights under an applicable collective agreement, individual contract of employment, law, regulations, work rules, custom or usage. Such claims involve questions relating to the interpretation or application of the rules. The term â€Å"Grievance† is used in countries to designate this type of claim, while in some other countries reference is made to disputes over â€Å"right† or â€Å"legal† disputes. The grounds for a grievance may be any measure or situation which concerns the relations between the employers and worker or which affects the conditions of employment of one or several workers in the undertaking when that measure or situation appears contrary to provisions of an applicable collective agreement or of an individual contract of employment, to work rules, to laws or regulations or to the custom or usage of the occupational branch of economy activity or country†. Causes for Grievance Grievances generally arise from the day to day working relations in an undertaking, usually a worker or trade union protest against or act or omission of management that is considered to violate worker rights. Grievances typically arise on such matters like discipline and dismissal, the payment of wages & other fringe benefits, working time, over time and time off entitlement, promotions, demotions and transfer, rights deriving from seniority, rights of supervisors and the Union officers, job classification problems, the relationship of works rules to the collective agreement and fulfillment of obligations relating to safety and health as laid down in the agreement. Such grievances, if not dealt with a procedure that secures the respect of parties, can result in embitterment of the working relationship and a climate of industrial strife. Procedure for Settlement: It has been widely recognized that there should be an appropriate procedure through which the grievances of workers may be submitted and settled. This recognition is based both on consideration of fairness and justice, which requires that workers’ claims regarding their rights should receive fair and impartial determination, and on the desire to remove from the area of power conflict a type of dispute that can properly be settled through authoritative determination of the respective rights and obligations of parties. Essence of Model Grievance Procedure: The three cardinal principles of grievance settlement, under the procedure, are; 1. Settlement at the lowest level, 2. Settlement as expeditiously as possible; and 3. Settlement to the satisfaction of the aggrieved Like justice, grievance must not only be settled but also seem to be settled in the eyes of the aggrieved. The Model Grievance Procedure has a three tier system for the settlement at the levels of the 1. immediate supervisor; 2. departmental or factory head; 3. and a bipartite grievance committee representing the management and the union, with a provision for the arbitration appeal to the organization head, and a specified time limit for the resolution process. Views of the National Commission on Labour NCL has recommended that a formal grievance procedure should be introduced in units employing 100 or more workers and they are: 1. There should be a statutory backing for the formulation of an effective grievance procedure which should be simple, flexible, less cumbersome and more or less n the lines of Model Grievance Procedure, 2. It should be time bound and have a limited number of steps namely, approach to the immediate supervisory staff; appeal to the departmental head/manager; and appeal to the bipartite grievance committee representing management and the recognized Union. 3. A grievance procedure should be such that it gives a sense of satisfaction to the individual worker, ensures reasonable exercise of authority to the manager and a sense of participation to Unions, 4. The constitution of the grievance committee should have a provision that in case a unanimous decision is not possible, the unsettled grievance may be referred to arbitration. At the earlier stages the worker should be free to be represented by a co worker and later by an officer of the union, if one exists, 5. It should be introduced in all units employing 100 or more workers. INDISCIPLINE/MISCONDUCT Discipline is the employee self control which prompts him to willingly co- operates with the organizational standards, rules, objectives, etc. Misconduct is the transgression of some established and definite rules where no discrimination is left to the employee. It is violation of rules. Any breach of these rules and discipline may amount to misconduct. It is an act or conduct which is prejudicial to the interest of the employer or is likely to impair the reputation of the employer or create unrest and can be performed even outside the premises of the establishment and beyond duty hours. It is for the management to determine in its Standing Orders as to what shall constitutes acts of misconduct and to define the quantum of punishment for them. Causes of misconduct: †¢ †¢ Unfair labour practices and victimization on the part of employers, like wage diffentials, declaration of payment or non payment of bonus, wrongful works assignments, defective grievance procedure etc., †¢ †¢ Bad service conditions, defective communications by superiors and ineffective leadership lead to indiscipline, †¢ †¢ Poverty, frustration, indebtedness, generally overshadow the minds of the workers, these agitate their minds and often result in indiscipline, †¢ †¢ Generally speaking absenteeism, insubordination, dishonesty and disloyalty, violation of plant rules, gambling, incompetence, damage to machine and property, strikes, etc., all lead to industrial indiscipline. Remedial Measure for Acts of Indiscipline: †¢ †¢ Labour is most important factor of production. Therefore an Organization can prosper only if labour is properly motivated towards the attainment of specific goals. A more humane approach is necessary to motivate them. †¢ †¢ Each worker, as an individual, needs a fair or reasonable wage to maintain himself and his family in good health and spirits. So the wage should be adequate so that the worker may meet the economic needs of his family, †¢ †¢ He Trade Union leadership should be developed from within the rank and file of workers, who would understand their problems and put it up to the management in the right perspective. Disciplinary Action: Indiscipline is the result of many interrelated reasons- economic, psychological, social etc. It needs to be properly handled. The disciplinary action must conform to certain principles e.g. †¢ †¢ The principal of natural justice must guide all enquiries and actions. No biased person to conduct inquiry, †¢ The principal of impartiality or consistency must be followed, †¢ †¢ The disciplinary authority should offer full opportunity to the worker to defend himself . Procedure for Punishment: †¢ Framing and Issuing of Charge sheet †¢ †¢ Receiving the defendants’ Explanation †¢ †¢ Issuing the notice of Inquiry †¢ †¢ Holding the Enquiry †¢ †¢ Findings of the Inquiry Officer †¢ †¢ Decision of the Disciplinary Authority †¢ †¢ Communication of the Order of Punishment Termination of Employment: †¢ †¢ Voluntary abandonment of Service by the Employee †¢ †¢ Resignation by the employee †¢ †¢ Discharge by notice thereof given by the employer †¢ †¢ Discharge or dismissal by the employer as a punishment for misconduct, †¢ †¢ Retirement on reaching the age of superannuation Type of Punishment Under Standing Orders: 1. Censure or Warning 2. Fines 3. Suspension 4. Dismissal Best of Luck†¦.. Sample of labour grievance handling policy in a manufacturing unit: As a matter of Labour Policy name of the company, hereby lays down the following procedure for addressing employees’ grievances 1 An employee who has any grievances viz., (a) A complaint against their supervisor or co-worker (b) Problems related to methods or systems in the production floor (c) Inconveniences caused due to work environment (d) Disturbances caused by personal problems in the factory premises etc. 2 Apart from the above the management may take other problems which it may consider relevant 3 The aggrieved worker shall inform their problems in writing to any one of the following – Factory Manager Technical Manager Admin Officer Welfare Officer 4 The gist of grievances of the employee shall be recorded in Employee’s Grievance Register mentioning the date and reference number if any 5 The registered complaints will be addressed within 48 hours 6 Employee may also drop their letter of grievance in the suggestion/complaint boxes kept in the production floor. 7 If the problem stated in the letter is found crucial the Factory Manager shall call concerned department head explanation and may order for enquiry. 8 The enquiry shall be done and redressal shall be made as per the company’s standing orders in force. 9 The action taken by the management will be recorded 10 The management shall refer the problems registered and action taken to solve it periodically and thus monitor the situation and ensure that the problems are not repeated. This policy on procedure for redressal is introduced to ensure good working environment in the factory, maintained at all time. NOTICE BY MINISTRY OF LABOUR FOR HANDLING GRIEVANCES & DISPUTES AMONG EMPLOYEES!! MINISTRY OF LABOUR AND EMPLOYMENT NOTIFICATION New Delhi , the 15th September, 2010 S.O. 2278(E).- In exercise of the powers conferred by sub-section (2) of Section 1 of the Industrial Disputes (Amendment) Act, 2010 (24 of 2010), the Central Government hereby appoints the 15 th Day of September, 2010, as the date on which the said Act shall come into force. [F.No.S-11012/1/2007-IR(PL)] RAVI MATHUR, Addl. Secy. THE INDUSTRIAL DIPSUTES (AMENDMENT) ACT, 2010 No.24 OF 2010 [18 th August, 2010] An Act further to amend the Industrial Disputes Act, 1947. Be it enacted by Parliament in the Sixtieth Year of the Republic of India as follows:- 1. (1) This Act may be called the Industrial Disputes (Amendment) Act, 2010. (2) It shall come into force on such date as the Central Government may, by notification in the Official Gazette, appoint. 2. In the Industrial Disputes Act, 1947 (hereinafter referred to as the principal Act), in section 2, -. (i) in clause (a),- (a) in sub-clause (i), for the words â€Å"major port, the Central Government, and†, the words â€Å"major port, any company in which not less than fifty-one per cent of the paid-up share capital is held by the Central Government , or any corporation, not being a corporation referred to in this clause, established by or under any law made by Parliament, or the Central public sector undertaking , subsidiary companies set up by the principal undertaking and autonomous bodies owned or controlled by the Central Government, the Central Government and† shall be substituted: (b) for sub-clause (ii), the following sub-clause shall be substituted, namely:- â€Å"(ii) in relation to any other industrial dispute , including the State public sector undertaking, subsidiary companies set up by the principal undertaking and autonomous bodies owned or controlled by the State Government, the State Government.†; Provided that in case of a dispute between a contractor and the contract labour employed through the contractor in any industrial establishment where such dispute first arose, the appropriate Government shall be the Central Government or the State Government, as the case may be, which has control over such industrial establishment.†; (ii) in clause (5), in sub-clause (iv), for the words â€Å"one thousand six hundred rupees†, the words â€Å"ten thousand rupees† shall be substituted. 3. Section 2A of the principal Act shall be numbered as sub-section (1) thereof and after sub-section (l) as so numbered, the following sub-sections shall be inserted, namely:- â€Å"(2) Notwithstanding anything contained in section 10, any such workman as is specified in sub-section (1) may, make an application direct to the Labour Court or Tribunal for adjudication of the dispute referred to therein after the expiry of three months from the date he has made the application to the Conciliation Officer of the appropriate Government for conciliation of the dispute, and in receipt of such application the Labour Court or Tribunal shall have powers and jurisdiction to adjudicate upon the dispute, as if it were a dispute referred to it by the appropriate Government in accordance with the provisions of this Act and all the provisions of this Act shall apply in relation to such adjudication as they apply in relation to an industrial dispute referred to it by the appropriate Government. (3) The application referred to in sub-section (2) shall be made to the Labour Court or Tribunal before the expiry of three years from the date of discharge, dismissal, retrenchment or otherwise termination of service as specified in sub-section (1).† 4. In section 7 of the principal Act, in sub-section (3), after clause (e), the following clauses shall be inserted, namely:- â€Å"(f) he is or has been a Deputy Chief Labour Commissioner (Central) or Joint Commissioner of the State Labour Department , having a degree in law and at least seven years’ experience in the labour department after having acquired degree in law including three years of experience as Conciliation Officer: Provided that no such Deputy Chief Labour Commissioner or Joint Labour Commissioner shall be appointed unless he resigns from the service of the Central Government or State Government, as the case may be, before being appointed as the presiding officer; or (g) he is an officer of Indian Legal Se rvice in Grade III with three years’ experience in the grade.† 5. In section 7A of the principal Act, in sub-section (3), after clause (aa), the following clauses shall be inserted, namely:- â€Å"(b) he is or has been a Deputy Chief Labour Commissioner (Central) or Joint Commissioner of the State Labour Department, having a degree in law and at least seven years’ experience in the labour department after having acquired degree in law including three years of experience as Conciliation Officer: Provided that no such Deputy Chief Labour Commissioner or Joint Labour Commissioner shall be appointed unless he resigns from the service of the Central Government or State Government, as the case may he, before being appointed as the presiding officer; or (c) he is an officer of Indian Legal Service in Grade III with three years’ experience in the grade.† 6. After section 9B of the principal Act, for chapter IIB, the following Chapter shall be substituted, namely:- â€Å"CHAPTER IIB GRIEVANCE REDRESSAL MACHINERY 9C. (l) Every industrial establishment employing twenty or more workmen shall have one or more Grievance Redressal Committee for the resolution of disputes arising out of individual grievances. (2) The Grievance Redressal Committee shall consist of equal number of members from the employer and the workmen. (3) The chairperson of the Grievance Redressal Committee shall be selected from the employer and from among the workmen alternatively on rotation basis every year. (4) The total number of members of the Grievance Redressal Committee shall not exceed more than six: Provided that there shall be, as far as practicable, one woman member if the Grievance Redressal Committee has two members and in case the number of members are more than two, the number of women members may be increased proportionately. (5) Notwithstanding anything contained in this section, the setting up of Grievance Redressal Committee shall not affect the right of the workman to raise industrial dispute on the same m atter under the provisions of this Act. (6) The Grievance Redressal Committee may complete its proceedings within forty-five days on receipt of a written application by or on behalf of the aggrieved party. (7) The workman who is aggrieved of the decision of the Grievance Redressal Committee may prefer an appeal to the employer against the decision of Grievance Redressal Committee and the employer shall, within one month from the date of receipt of such appeal, dispose off the same and send a copy of his decision to the workman concerned. Nothing contained in this section shall apply to the workmen for whom there is an established Grievance Redressal Mechanism in the establishment concerned.† 7. In section 11 of the principal Act, after sub-section , the following sub-sections shall be inserted, namely:- â€Å"(9) Every award made, order issued or settlement arrived at by or before Labour Court or Tribunal or National Tribunal shall be executed in accordance with the procedure laid down for execution of orders and decree of a Civil Court under order 21 of the Code of Civil Procedure , 1908. (10) The Labour Court or Tribunal or National Tribunal, as the case may be, shall transmit any award, order or settlement to a Civil Court having jurisdiction and such Civil Court shall execute the award, order or settlement as if it were a decree passed by it.† 8. In section 38 of the principal Act, in sub-section (2),- (i) clause (ab) shall be omitted; (ii) for clause (c), the following clause shall be substituted, namely:- â€Å"(c) the salaries and allowances and the terms and conditions for appointment of the presiding officers of the Labour Court, Tribunal and the National Tribunal including the allowances admissible to members of Courts, Boards and to assessors and witnesses;†.

Cyber Crime & internet

The full realization of the potential benefits brought by internet in the global community is greatly sabotaged by cyber crime activities. Cyber crime is increasingly becoming a major concern across the social, scientific, economic, and law enforcement fronts of the global community. Although the actual economic impact of cyber crimes is hard to qualify, it is estimated that the American nation looses over $100 million on internet related crimes every year. There are numerous types of cyber crimes (Laser, 2009).These includes; identity theft, fraud, hacking, cyber terrorism, malicious computer programs, web posting of offensive materials, and drug trafficking among others. Due to the negative social and economic impact of cyber crime activities, governments and other stakeholders have engaged in a number of prevention measures. They encompass creation of public awareness to enable internet users to identify, report, and/or avoid being victims of such crimes (McDowell, 2008). Software scientists have also engaged in developing effective computer and network security software.In addition to this, there are laws such as the Intellectual Property Law, Electronic Communication Privacy Law, and the 2001 Patriotic Act serve an important role in detecting and prosecuting cyber crime offenders. This essay seeks to discuss malicious computer programs (also know as malware) as a form of cyber crime, its characteristics and how it is prevented, detected, and/or prosecuted. Malicious computer programs are defined as coded programs, which serve either to corrupt the effective functioning of a computer system or lead to unwarranted remote accessing of information from a computer network (Loader, Douglas, & Thomas, 2000).Viruses and worms are the most common types of malicious computer programs or software. Other malicious computer programs include spyware, and Trojan. They are codes which serve to compromise information stored in computer network devices. This type of malicio us computer programs is commonly associated with infecting executable computer files and denial of network access by authorized users (Loader, Douglas, Thomas, 2000). Indeed, through extensive infecting of computer files, such codes are responsible for crashing of computer network devices.Other common forms of malicious computer programs are deceptive Trojan horses, multi-purpose bots, and spyware programs. This is increasingly becoming a common cyber crime. Such programs are characterized by their ability to allow for the stealing of sensitive information from protected networks (Metropolitan Police, 2009). According to available information on these malicious computer programs, they can serve to aid a hacker in remotely accessing passwords and credit card details of network users without detection.In addition, due to their sophisticated capability, such programs are employed for facilitating corrupting of confidential information stored institutional networks (Loader, Douglas, & T homas, 2000). Such can also be used by terrorist groups to qualify the crucial information from their target government prior to attacks. There are numerous ways established for preventing malicious computer programs as a cyber crime activity. The most common measure is the creation of awareness among the general public and institutions on how to identify and mitigate being affected malicious computer programs (McDowell, 2008).To realize this preventive measure, network software scientists have engaged in numerous researches; developing highly intelligent network security software. Indeed, some software such as antivirus are commonly found free in the internet. Such are serving the crucial purpose of mitigating infection of computer networks by malicious computer codes such as virus and worm among others. Still, this intelligent network security software brings with them the ability to identify and deny access of systems by unauthorized users (Lasar, 2009).According to available res earch findings on the effectives of malicious computer programs, it is clearly established that some forms of these programs which are hard to control. In a move to protect the integrity of information technology in the society, it is a common practice for highly sensitive institutions to close down their networks upon realizing any errant behaviors. It is worth noting that such moves are instrumental in ensuring the continued illegal access of networks by hackers. This is usually followed by a change of the overall access security codes and other check requirements.Indeed, for security codes of highly sensitive institutional networks, constant changing is recommended to reduce access chances by hackers. The process of detecting and prosecuting cyber crimes is quite complex. This has been closely attributed to the fact that offenders in these crimes employ high sophisticated technologies (Metropolitan Police, 2009). It is commonly claimed that thieves are usually ahead of technology . Another problem compromising the process of detecting and prosecuting malicious computer programs crime offenders is low rates of reporting such crimes by the victims (McDowell, 2008).Such have also been associated by the failure of network company providers to cooperate with the law enforcement in identifying such incidences. Despite these drawbacks, the war on malicious computer programs as a cyber crime activity has employed a number of methods. First is the use of computer forensic investigation practices to qualify evidence of suspect malicious computer program offender (Lasar, 2009). This process involves technological analysis of collected data by forensic computer scientists.It is to be underscored that according to existing laws such as the Intellectual Property Law and Electronic Communication Privacy Law provides for legal suits against the programmers and distributors of malicious computer programs (Loader, Douglas, Thomas, 2000). Another commonly used measure in detec ting cyber crimes is the tapping of communication networks by law enforcement agents. Although this method has received heavy critics for interfering with the privacy and confidentiality of communication, it serves great purpose in mitigating unwarranted access of sensitive networks.The Patriotic Act of 2001, which allows for government surveillance of the internet, is aimed at mitigating terrorist activities. According to the provisions of the Act, law enforcement is given legal authority to intercept internet communications by crime suspects. Another crucial provision of the Act is its mandatory dictate for network providers to cooperate with the law enforcement in identifying the original of a given communication of malicious programs. Based on this reason, the process of detecting malicious computer programs has significantly improved with the enforcement of the Patriotic Act.Another measure of detecting cyber crime activities is the modern streamlining of the reporting and resp onsiveness practices in the law enforcement (McDowell, 2008). This encourages institutions and individual victims of malicious computer programs to report such incidences, thus enhancing the process of mitigating such criminal activities by the law enforcement agencies. In conclusion, the escalating problem of cyber crime activities is increasingly compromising the realization of the potential benefits brought internet technological advancements in the community.Although all cyber crimes have negative social and economic impacts in the society, malicious computer programs are a real threat to the security of nations across the global. Such programs are evidently blamed for corrupting executable computer network file, crashing of network devices, denying access by authorized users, and allowing access of private information by hackers. Therefore, there is need for more consulted efforts by the computer security software scientists, law enforcement, and other stakeholders to engage in formulating effective measures of fighting cyber crime. References Lasar, M. (2009).An introduction to the FBI’s anti-cyber crime network. Retrieved May 28, 2010, from http://arstechnica. com/web/news/2009/11/an-introduction-to-the-fbis-anti-cybercrime-network. ars Loader, B. , Douglas, T. , & Thomas, D. (2000). Cyber crime: Law Enforcement, Security, and Surveillance in the Information. New York: Routledge. McDowell, M. (2008). National Cyber Alert System. Retrieved May 28, 2010, from http://www. us-cert. gov/cas/tips/ST05-006. html Metropolitan Police. (2009). Trojan’ computer arrests. Retrieved May 28, 2010, from http://cms. met. police. uk/news/arrests_and_charges/trojan_computer_virus_arrests