The Effects Of Mental Skills On Sports Psychology

The use of mental skills in sports psychology can both benefit an athlete to motivate themselves and provide them with the self confidence to achieve although the use of these skills can also have a negative impact on the athlete. There are multiple studies that have been carried to support the use of mental skills in a rehabilitation programme for example studies by JJ. This review of literature includes two different types of mental skills that can be used to help an athlete in the rehabilitation process, one study to support the concept that athletes benefit from a range of mental skills use is Arvinen-Barrow et al. This study that took place in 2015 found out that 71.6% of 1283 athletes indicated that they believed mental skills helped them to rehabilitate faster when using 3 types of mental skills (imagery,goal setting and positive self talk).However there are times in an athletes career were they will be injured and confidence may be at a low point as they struggle to cope wit h the demands of reaching the heights they may have previously set. A study which argues against the positives of mental skills more specifically relaxation and imagery is one conducted by Francis, Andersen and Maley (2000). The results from this study backed up the idea that positive self talk and positive reinforcement from an external individual can help the rehabilitation process. However the athletes used in this study did not believe that other mental skills such as relaxation or imageryShow MoreRelatedThe Effects Of Mental Skills On Sports Psychology1932 Words   |  8 PagesIntroduction The use of mental skills in sports psychology can both benefit an athlete to motivate themselves and provide them with the self confidence to achieve although the use of these skills can also have a negative impact on the athlete. This review of literature includes two different types of mental skills that can be used to help an athlete in the rehabilitation process, one study to support the concept that athletes benefit from a range of mental skills use is Arvinen-Barrow et al. ThisRead MorePsychology : Psychology And Social Psychology1398 Words   |  6 Pagesanswer in his lifetime. Psychology is a very broad topic in general, and is easily broken down into two main categories: experimental psychology and social psychology. These two categories of psychology can be broken down further into many subcategories such as the following: clinical psychology, forensic psychology, and sports psychology. Both of these broad categories, nevertheless, share the same end goal, which is to unde rstand the human mind and its functions. Psychology defined in the Merriam-WebsterRead MoreEssay about Mental Rehearsal Key to Improving Athlete Performance1706 Words   |  7 Pagesâ€Å"Physical repetition alone will not get the job done in mastering a skill and taking an athlete or team to the next level; imagery is equally, if not more important.† (Mallett). Many people believe that although the sport is played with the body, it is won by the mind. Not surprisingly sport performers increasingly turn to psychology in an effort to gain a winning edge over their rivals. In this sense, mental imagery, or the ability to represent the minds information that is not currently being perceivedRead MoreWhat is Sport Spsychology?853 Words   |  3 Pages Your Guide to sport psychology-Every weekend professional soccer players play in front of 60,000 and many more watching on TV. Yet, they stay focused and confident thorough there 90-minute battle. It fascinated me that how these players are able to do this consistently without many hiccups. The Idea that simple techniques applied by sport psychologists could make such a big difference in an athlete’s performance is what I find out during my non-fiction journey. Sport Psychology in the trainingRead More Applying Psychological Thinking To Sports Essays1687 Words   |  7 Pages quot;Sports is by far one of the fastest growing pass times in the United Statesquot; (Rainer 1987). Even if people dont take it to the professional level, sporting events are happening in our backyards, and at all of our local schools around the country. With the growing popularity and the increasing competitiveness of the sports, it will take more than just a physical advantage to compete at the highest level. This is where the psychology of sports comes into play. In my research I willRead MoreDifferent Disciplines Of Sports And Exercise Essay1465 Words   |  6 PagesDifferent disciplines are kept in check by different governing bodies. These governing bodies make sure practitioners are correct in practice and state what they can and cannot do. There are many different disciplines within sport and exercise science and they all have different approaches to improve sporting performance and health. Governing body’s reason for existence is to set out policies and rules within an institution to make sure practitioners are morally ethically and legally correct. GoverningRead MoreInside Sport Pschology830 Words   |  3 PagesIntroduction Inside Sport Psychology examines different sport psychology elements that can be transferred into every day coaching. Costas Karageorghis and Peter Terry discuss sports applications that prove helpful to coaches, athletes, team managers as well as students of sports psychology. The applications that are presented are applicable on the sports field in addition to other areas of our lives. Because athletes recognise the effect of psychology, many feel as if they have no or little controlRead MoreChildren and Sports Essay1053 Words   |  5 PagesChildren who participate in sports are developing rapidly in sports skills, sportsmanship, and psychologically, but does this come from organized sports are just nature’s process. Children develop emotional and social benefits from participating in sports. Children experience character and leadership development through peer relations leading to an increase in self-esteem and a decrease in anxiety levels. Children will get opportunit ies to experience positive and negative emotions throughout theirRead MoreCareer Plan For An Athletic Career Planning Program Essay1394 Words   |  6 PagesStambulova, 2010). An evaluation of methods, outcomes, and limitations of preexisting models will ideally benefit the overall strength and clinical utility of the current program. In addition to career-planning models, an athlete transitioning out of sport would also likely benefit from incorporating wellness models, as wellness models have improved individuals’ exercise activity, self-efficacy, and job satisfaction (Connolly Myers, 2003; Gieck, Olsen, 2007). Several wellness models currently inRead MoreTaking a Look at Sports Psychology1561 Words   |  6 PagesCome on – don’t let the picture creep into your mind. Stop thinking of that†¦ Pink Elephant (Gardner). It has been proven that putting a â€Å"don’t† or a â€Å"not† into a statement can cause the brain to have diffi culties in interpreting the statement. In sports, players tend to tell themselves â€Å"not† to do something. In soccer, a goalie might tell him/herself to not let the other team score a goal, and then the team does. Or in tennis, players tell themselves not to serve the ball into the net, and then they The Effects Of Mental Skills On Sports Psychology Introduction The use of mental skills in sports psychology can both benefit an athlete to motivate themselves and provide them with the self confidence to achieve although the use of these skills can also have a negative impact on the athlete. This review of literature includes two different types of mental skills that can be used to help an athlete in the rehabilitation process, one study to support the concept that athletes benefit from a range of mental skills use is Arvinen-Barrow et al. This study took place in 2015, found out that 71.6% of 1283 athletes indicated that they believed mental skills helped them to rehabilitate faster when using 3 types of mental skills (imagery,goal setting and positive self talk). On the other hand there are studies which argue against the positives of mental skills more specifically relaxation and imagery and one example is a study conducted by Francis, Andersen and Maley (2000). The results from this study backed up the idea that positive self talk and posit ive reinforcement from an external individual can help the rehabilitation process. However the athletes used in this study did not believe that other mental skills such as relaxation or imagery were particularly useful in the rehabilitation phase. Furthermore when athletes return to physical activity there are theories that they are often feared of the injury occurring again and may not give themselves the best chance to perform at their previous standards. The following examples ofShow MoreRelatedThe Effects Of Mental Skills On Sports Psychology1923 Words   |  8 PagesThe use of mental skills in sports psychology can both benefit an athlete to motivate themselves and provide them with the self confidence to achieve although the use of these skills can also have a negative impact on the athlete. There are multiple studies that have been carried to support the use of mental skills in a rehabilitation programme for example studies by JJ. This review of literature includes two diff erent types of mental skills that can be used to help an athlete in the rehabilitationRead MorePsychology : Psychology And Social Psychology1398 Words   |  6 Pagesanswer in his lifetime. Psychology is a very broad topic in general, and is easily broken down into two main categories: experimental psychology and social psychology. These two categories of psychology can be broken down further into many subcategories such as the following: clinical psychology, forensic psychology, and sports psychology. Both of these broad categories, nevertheless, share the same end goal, which is to understand the human mind and its functions. Psychology defined in the Merriam-WebsterRead MoreEssay about Mental Rehearsal Key to Improving Athlete Performance1706 Words   |  7 Pagesâ€Å"Physical repetition alone will not get the job done in mastering a skill and taking an athlete or team to the next level; imagery is equally, if not more important.† (Mallett). Many people believe that alt hough the sport is played with the body, it is won by the mind. Not surprisingly sport performers increasingly turn to psychology in an effort to gain a winning edge over their rivals. In this sense, mental imagery, or the ability to represent the minds information that is not currently being perceivedRead MoreWhat is Sport Spsychology?853 Words   |  3 Pages Your Guide to sport psychology-Every weekend professional soccer players play in front of 60,000 and many more watching on TV. Yet, they stay focused and confident thorough there 90-minute battle. It fascinated me that how these players are able to do this consistently without many hiccups. The Idea that simple techniques applied by sport psychologists could make such a big difference in an athlete’s performance is what I find out during my non-fiction journey. Sport Psychology in the trainingRead More Applying Psychological Thinking To Sports Essays1687 Words   |  7 Pages quot;Sports is by far one of the fastest growing pass times in the United Statesquot; (Rainer 1987). Even if people dont take it to the professional level, sporting events are happening in our backyards, and at all of our local schools around the country. With the growing popularity and the increasing competitiveness of the sports, it will take more than just a physical advantage to compete at the highest level. This is where the psychology of sports comes into play. In my research I willRead MoreDifferent Disciplines Of Sports And Exercise Essay1465 Words   |  6 PagesDifferent disciplines are kept in check by different governing bodies. These governing bodies make sure practitioners are correct in practice and state what they can and cannot do. There are many different disciplines within sport and exercise science and they all have different approaches to improve sporting performance and health. Governing body’s reason for existence is to set out policies and rules within an institution to make sure practitioners are morally ethically and legally correct. GoverningRead MoreInside Sport Pschology830 Words   |  3 PagesIntroduction Inside Sport Psychology examines different sport psychology elements that can be transferred into every day coaching. Costas Karageorghis and Peter Terry discuss sports applications that prove helpful to coaches, athletes, team managers as well as students of sports psychology. The applications that are presented are applicable on the sports field in addition to other areas of our lives. Because athletes recognise the effect of psychology, many feel as if they have no or little controlRead MoreChildren and Sports Essay1053 Words   |  5 PagesChildren who participate in sports are developing rapidly in sports skills, sportsmanship, and psychologically, but does this come from organized sports are just nature’s process. Children develop emotional and social benefits from participating in sports. Children experience character and leadership development through peer relations leading to an increase in self-esteem and a decrease in anxiety levels. Children will get opportunit ies to experience positive and negative emotions throughout theirRead MoreCareer Plan For An Athletic Career Planning Program Essay1394 Words   |  6 PagesStambulova, 2010). An evaluation of methods, outcomes, and limitations of preexisting models will ideally benefit the overall strength and clinical utility of the current program. In addition to career-planning models, an athlete transitioning out of sport would also likely benefit from incorporating wellness models, as wellness models have improved individuals’ exercise activity, self-efficacy, and job satisfaction (Connolly Myers, 2003; Gieck, Olsen, 2007). Several wellness models currently inRead MoreTaking a Look at Sports Psychology1561 Words   |  6 PagesCome on – don’t let the picture creep into your mind. Stop thinking of that†¦ Pink Elephant (Gardner). It has been proven that putting a â€Å"don’t† or a â€Å"not† into a statement can cause the brain to have diffi culties in interpreting the statement. In sports, players tend to tell themselves â€Å"not† to do something. In soccer, a goalie might tell him/herself to not let the other team score a goal, and then the team does. Or in tennis, players tell themselves not to serve the ball into the net, and then they

Annotated Bibliography Brand Loyalty from a Multi-Faceted...

Annotated Bibliography Brand Loyalty from a Multi-faceted Perspective ORGA 201 Introduction to Management Section OP51 Max Su (1762788) Instructor: Rob Dean Brand loyalty is the ‘Holy Grail’ to all marketing organizations. Marketing practitioners are consumed by it. They search. They try. They dream. They want to achieve the ultimate in brand loyalty, making it so airtight that no competition can lure their consumers from their brands of products. Unfortunately, there is no one-size-fit-all methodology. Competition is dynamic. There’s no way to accurately anticipate what the creativity of their competitors can bring to the marketplace, which can lead to†¦show more content†¦The authors describe ethical burden as the necessity of company to charge real cost of doing business, ensure quality of products and services and develop strong customer relations. The focus group study with a sample of 50 business professionals contends that by managing ethical burden with continuous advertising, it can lead to creating positive brand image and hence, brand loyalty, that will sustain the brand in the long te rm through repeat buying phenomena. Babur is an Assistant Professor and Principal at ISRA University, Islamabad Campus Pakistan. Naveed is a Senior Research Associate at Riphah International University, Islamabad Pakistan. There are 15 references in this article. The authors use these references to elaborate on concepts relating to marketing in regards to ethical burden, brand image, brand loyalty and, advertising in general. The results of the study indicate that a large portion of the repeat buying behavior is due to unexplained factors across purchasing occasions. The authors state that this study has a 72% of reliability, but did not show the calculation of how the number was derived. The written English is weak and some descriptions are not so clear. Despite this deficiency, this article provides marketing managers with another perspective to sustain brand loyalty. In regards to the 72% reliability, further research can incorporate quantitative methods of research to indentify outliers, which can lead to a more accurate

Sardanapalus Essay Paper Example For Students

Sardanapalus Essay Paper A monologue from the play by Lord Byron NOTE: This monologue is reprinted from Lord Byron: Six Plays. Lord Byron. Los Angeles: Black Box Press, 2007. MYRRHA: Why do I love this man? My countrys daughtersLove none but heroes. But I have no country!The slave hath lost all save her bonds. I love him;And thats the heaviest link of the long chain—To love whom we esteem not. Be it so:The hour is coming when hell need all love,And find none. To fall from him now were baserThan to have stabbed him on his throne when highestWould have been noble in my countrys creed:I was not made for either. Could I save him,I should not love him better, but myself;And I have need of the last, for I have fallenIn my own thoughts, by loving this soft stranger:And yet, methinks, I love him more, perceivingThat he is hated of his own barbarians,The natural foes of all the blood of Greece.Could I but wake a single thought like thoseWhich even the Phrygians felt when battling longTwixt Ilion and the sea, within his heart,He would tread down the barbarous crowds, and triumph.He loves me, and I love him; the slave lovesHer master, and would free him from his vices.If not, I have a means of freedom still,And if I cannot teach him how to reign,May show him how alone a King can leaveHis throne.

The changing roles of men and women in families in Britain over the past half century Essay Example

The changing roles of men and women in families in Britain over the past half century Essay For much of the long history of human civilization women and men evolved to assume different roles within the family and larger society. But in most societies, women were made to take a subordinate social and domestic role to men. This situation has gradually changed in the last fifty years and there is more equality between the statuses of the two sexes. Two important circumstances have made female emancipation possible. Firstly, as works of female authors started to get published, societies got exposed to the feminine perspective on various subjects. Secondly, events such as the Second World War had radically altered women’s roles by bringing them out of their homes and into factories. The women suffragette movement that took place in the early decades of the 20th century and the Women’s rights movement of the 1960s were also instrumental in bringing about substantial change in the status and role of women (Allan Crow, 2001, p.21). These changes were not restr icted to Britain, but have occurred simultaneously in many countries, especially in West. While the role of women has seen remarkable change over the last half century, the same cannot be said of the role of men. Some of the specific areas where gender roles in Britain have morphed over the recent decades are discussed in this essay. There is no doubt that women have steadily taken a prominent role in the workplace and that their participation in it has increased gradually over the last five decades. Half a century back men were deemed the sole bread-winners for their families and women were confined to domestic work and bringing up children (Morgan, 1990, p.15). But today’s Britain is a far cry from what was the case in 1960s. Since the circumstances of the Second World War forced women into taking up roles that were conventionally restricted to men, there has been no looking back in terms of their economic independence (Davies, 2004, p. 260). Previously, women had to put up with abusive husbands due to their economic dependency on the latter. But as more women became financially independent, their freedoms in regard to interpersonal relationships also grew. It should be remembered though, that despite possessing equal professional qualifications, work experience and skill sets, most women tend to g et paid less than their husbands (Walters Avotri, 1999). For example, we find that despite progress in many areas, the gender wage gap is a clear-cut sign that women still have some way to go before achieving an equal status to their husbands. What is worrying about the persistent gender wage gap is the fact that women don’t feel as indignant about this issue as they do in other areas of inequality (Allan Crow, 2001, p.21). In addition to this, British culture and history have stereotyped what comprise feminine qualities. The following observation from research team of Chichilnisky et. al. further elucidates this point: We will write a custom essay sample on The changing roles of men and women in families in Britain over the past half century specifically for you for only $16.38 $13.9/page Order now We will write a custom essay sample on The changing roles of men and women in families in Britain over the past half century specifically for you FOR ONLY $16.38 $13.9/page Hire Writer We will write a custom essay sample on The changing roles of men and women in families in Britain over the past half century specifically for you FOR ONLY $16.38 $13.9/page Hire Writer â€Å"notwithstanding the fact that today’s women and men share the same starting point for becoming equally productive in both the home and the workplace–current beliefs about earnings may be â€Å"historically biased† in favour of stereotypes. This reasoning leads us to argue that persistence of the gender wage gap in developed societies can possibly be explained by a self-fulfilling â€Å"history bias† in beliefs.† (Chichilnisky et. al., 2008, p.299) But beyond the â€Å"history bias†, there are other factors that contribute to gender wage gap within the family. While the absolute percentage of women participating in workforce has increased, the stereotyping of feminine qualities has restricted the domains in which they could specialize. As a result, women and men are segregated occupation-wise, where there is wage-disparity between occupations. There is also disparity between women and men of the same age-groups due to the fact that the former lose a few years for maternity and child-rearing which holds back their career’s progress. So while economic opportunities for women have expanded and consequently their roles within the family have changed since the 1950s, it has not propelled women to a state of equality with men today. (Walker, 2005, p.32) We can learn useful insights about gender roles in Britain by studying the foundation, organizational structure and other facets of the British Association of Barbershop Singers (BABS) – a popular musical organization that has worked with leading charities during the last half century and has also given performances in leading media outlets such as the BBC. The BABS is almost exclusively comprised of men, and the quartet music that is its highlight is sung by four talented men vocalists. When BABS is compared with its equivalent organization Ladies’ Association of British Barbershop Singers, we see that both these associations conduct elections to pick their executives and administrators. The elected members in turn report and give an account of their activities to a national council. Duties such as serving as judges in musical competitions, offering musical education, are taken over by another music team – the Music and Judging Committee in the case of LABBS and Guild of Judges in the case of BABS (Garnett, 1999, p.115). Both of these barbershop organizations print and distribute newsletters, retail sheet music and release albums. The importance of this symmetry in organizational structure and functioning is that â€Å"it departs radically from a conception of separate spheres that characterizes them not only by gender but by social space. While the nineteenth-century formulation of the term mapped a distinction of public/private onto the gendered realms of activity, this twentieth-century reworking of the model takes its terms much more at face value by constituting both genders’ activities in the public realm of institutionalized regulation†. (Garnett, 1999, p.116) Hence, from the evidence gathered from the working of BABS and LABBS, we can infer that women enjoy more freedom and higher status both within and without the institution of family than was previously the case. But one should detest from drawing broad generalizations based on this evidence alone. For example, it is true that British women, being citizens of an advanced economic and industrial nation, have gained advantages over their counterparts in other nations. But it would be misleading to believe that the attitudes of British men have changed at all in the last half century, when compared to how men in other cultures view the role of women. For example, it is true that â€Å"Middle Eastern women are beaten for wearing un-Islamic clothing; Afghan women are abused and disenfranchised with or without the Taliban; Pakistani women are suffering domestic violence, including acid attacks and so-called ‘honour crimes’. If conventional discourse is to be believed, the front line in the ongoing struggle for universal women’s rights lies in the world’s poorest, most patriarchal and least democratic nations† (Walker, 2005, p.32). It is then argued that in countries like Britain, where the standard of democracy is high and citizen enfranchisement is advanced, women do not generally undergo discrimination, violence and abuse that their less privileged counterparts suffer. But scrutinized properly, it seems that the feminist movement of the 1960s and 1970s, and the rights won as a result of it, has given a sense of complacency and a misplaced sense of satisfaction to women (Allan Crow, 2001, p.23). The truth is less rosy than this as indicated by Amnesty International reports. Of all the advanced nations, the UK, the USA and Japan are striking examples of misconceptions about women’s liberation. For example, according to an Amnesty International report, â€Å"abuses of women’s rights in the developed world are occasionally reported fully and accurately–as in Amnesty UK’s campaigns on domestic violence–but in general they are portrayed as isolated incidents and contrasted with widespread repression in the developing world†¦whereas in truth, they demonstrate that abuses in developed and developing countries are linked† (Walker, 2005, p.32) This brings us to a key reason that has thwarted greater progress for women’s station in family during the last fifty years, namely deeply rooted sexual anxieties and insecurities of men. As scholars Werner Kierski and Christopher Blazina point out, one of the core reasons for the continuation of a subordinate role for women are men’s psychological fears of the opposite sex. What has been termed Fear of the Feminine (FOF) has been studied for close to two centuries now. But it was psychoanalyst Sigmund Freud who articulated clearly and at length some of these fear (the fear of men losing power over women expressed as ‘castration fear’). Later psychologists such as Horney refined and expanded this conception to account for men’s â€Å"dread of women and how this fear left men’s sense of masculinity on unstable ground† (Kierski Blazina, 2009, p.156). Carl Gustav Jung is said to have emphasized the importance of the feminine in his d efinitions of healthy and unhealthy masculinity. Further, FOF is also observed on a more socio-cultural level, affecting the roles of both genders. The phenomenon is said to emerge from entrenched patriarchal social models and/or fears of feminine underlying the origins of misogyny. Moreover, â€Å"Pielow (1998) refers to the feminine qualities living deep within the psyches of men as demonic forces. O’Neil et al (1986) widely used Gender Role Conflict Scale (GRCS) is theoretical built upon the FOF, men’s gender roles being derived in large part by the avoidance of those thoughts and behaviours seen as unmanly and connected to women. Nietzsche expressed his FOF clearly in his classic work, Thus Spoke Zarathrustra, by letting an old women offer the following advice to a man: â€Å"You go to women? Do not forget the whip!† (Kierski Blazina, 2009, p.158)

3 Steps to Becoming a Successful Admin Professional

3 Steps to Becoming a Successful Admin Professional Admins are a pretty competent and put together demographic. But we all have our own particular weaknesses- some we’re aware of, some we’re not! No matter your career stage, it never hurts to do a little self-assessment and see what can be improved.Step 1: Assess Your StyleEverybody has their own particular organizational style. Some people make lists. Some people clear out their inbox and sort messages into folders every hour on the hour. Some people have a gnarl of papers on their desk, but always know how to find the one they need! You may be a neat and tidy pile person, and you may not.There are great tests available online to self-assess. But no matter what you do, figuring out what works and doesn’t work for you is an important first step to figuring out what can and should be improved.Step 2: Build Your ToolboxThis is easier said than done, and does require a thorough investigation into Step 1. But once you know your weak areas, it will be much easier to fi nd and hone the tools to help you get them back up to snuff. Google and your trusted friends are a great resource here. So are colleagues whose organization systems you find awe-inspiring. A casual, â€Å"Hey, you have any strategies for file creep you feel like sharing?† People love to brag about how well they do things. They’ll never realize you just cried for help.Step 3: Know the CostIf you don’t shore up your weak spots, you could be wasting lots of your own time, your boss’s time, your company’s money. You could let things slip through the cracks and then forget them. Even if you don’t make any big mistakes, you might be constantly worried that you might, and that stress just isn’t worth it. Better to plug up all the holes in the boat and go forth with confidence that you’re steering it straight and true.Having good- no, great organization can only help you. It will build your reputation and respect level among your cowor kers and supervisors, and will keep you calm and confident in the fact that you’re aces at your job.

Apophasis in Rhetoric

Apophasis in Rhetoric Apophasis is a rhetorical term for the mention of something in disclaiming intention of mentioning itor pretending to deny what is really affirmed. Adjective: apophatic or apophantic. Also called denial or omission.  Similar to paralepsis and praeteritio. The Oxford English Dictionary defines apophasis by quoting John Smiths The Mysterie of Rhetorique Unvaild (1657): a kind of Irony, whereby we deny that we say or doe that which we especially say or doe. Bryan Garner notes that  [s]everal set phrases in our language signal  apophasis, such as not to mention, to say nothing of, and it goes without saying (Garners Modern English Usage, 2016).   Etymology:  From the Greek, denial Pronunciation:  ah-POF-ah-sis Examples Jeff FisherWe dont make excuses, but three of our four starting defensive linemen were watching the game today.Michele BachmannI find it interesting that it was back in the 1970s that the swine flu broke out then under another Democrat president, Jimmy Carter. And I’m not blaming this on President Obama. I just think it’s an interesting coincidence.Jacob V. LamarAt a White House press conference, a reporter working for a journal published by Extremist Lyndon LaRouche asked the President about rumors that Michael Dukakis once sought psychological help. Look, [President] Reagan replied with a smile, Im not going to pick on an invalid.Richard M. NixonLet me say, incidentally, that my opponent, my opposite number for the Vice Presidency on the Democratic ticket, does have his wife on the payroll and has had ither on his payroll for the ten yearsfor the past ten years. Now just let me say this: Thats his business, and Im not critical of him for doing that. You will have to p ass judgment on that particular point. San Fernando RedIm not going to throw mud at my opponent because hes a fine man. And his wife is a mighty fine woman. Mighty fine. What he sees in that dame hes running around with...The GuardianMary Matlin, the Bush campaigns political director, made the point with ruthless venom at a press briefing in Washington, saying, The larger issue is that Clinton is evasive and slick. We have never said to the press that he is a philandering, pot-smoking, draft-dodger. Theres nothing nefarious or subliminal going on.Robert Downey Jr., Iron Man 2Im not saying Im responsible for this countrys longest run of uninterrupted peace in 35 years! Im not saying that from the ashes of captivity, never has a phoenix metaphor been more personified! Im not saying Uncle Sam can kick back on a lawn chair, sipping on an iced tea, because I havent come across anyone man enough to go toe to toe with me on my best day! Its not about me.John MiltonI shall ignore the fact that Learning is youths finest ornament, the strong support of the prime of life, and the consolation of old age. I shall make no point of the fact that, after careers full of achievement and glory, many of the men who have been most honored by their contemporaries and many of the most eminent of the Romans withdrew from the conflict and hurly-burly of ambition to literary studies, as to a harbor and a delightful treat. Mayor Massimo CacciariIts not my habit to comment on books that dont interest me or, for various reasons, I dont like.Geoff DyerSo even though you’ve seen fit to wash your dirty linen in public like this, shorty, I will refrain from mentioning that it wasn’t me who turned up at the Islington Tennis Centre wearing a Rastafarian headband. 15–0! I also won’t sink low enough to point out that while I may have been the crappiest player of this quartet, my game would presumably have gotten off to a better start if, like you and Byng, I’d lived in a stately home with a tennis court in the back garden. 30–0! Byng: I’ll forget that you still owe me for your share of the indoor-court fee for that game on January  20, 2013. 40–0! As for Ardu, the world is better off not knowing about those famously dodgy line calls. Game, set, and match! Thomas Gibbons and Cicero on Apophasis Thomas GibbonsApophasis, or denial, is a Figure by which an Orator pretends to conceal or omit what he really and in fact declares.Cicero gives us a definition of this Figure, and furnishes us at the same time with instances of it in the following passage: Omission, says he, is when we say we pass over, or do not know, or will not mention, that which we declare with the utmost force. As in this manner: I might speak concerning your youth, which you have spent in the most abandoned profligacy, if I apprehended this was a proper season, but I now purposely wave it. I pass by the report of the Tribunes, who declared that you was [sic] defective in your military duty. The affair about the satisfaction concerning the injuries you had done to Labeo does not belong to the matter at hand: I say nothing of these things; I return to the subject of our present debate. . . .

Abortion laws in the state of Ohio Term Paper Example | Topics and Well Written Essays - 750 words

Abortion laws in the state of Ohio - Term Paper Example The state encourages the practice of a compulsive delay of 24 hours prior to the abortion (Laws). This 24 hour period is to be used for the purpose of state-directed counseling (Laws). This piece of counseling information must be handed over to the licensed physician, who is going to conduct the operation (Laws). This 24 hour consent law even makes it mandatory for a woman to give some information to the physician upon a face to face meeting (Laws). The physician must retrieve the following information from the patient:- (Laws). It is only after all the procedures are completed, that the patient gets to sign an informed consent (Laws). The patient even has to declare that she is not under the influence of any drugs or alcohol at that point of time (Laws). If a patient is less than 18 years of age, a parent, legal guardian or custodian must go along with her to the pre-abortion visit (Laws). The law even requires that the parent/legal guardian/custodian, give their Informed Consent on the abortion (Laws). From the above discussion we can conclude that the abortion laws in the state of Ohio have been designed by the government with the intention of protecting the innocent fetus from the brutal process of abortion. The laws have been formulated keeping in mind the complete safety of the patients. Also, the requirement of parent’s consent criteria sounds veritably justified enough for a healthy and happy society. Sweigart, Josh. â€Å"Area representative at center of Ohio abortion controversy†. Springfield News-Sun. 27 Mar. 2011. 28 Mar. 2011. OKeefe, Paul. â€Å"Proposed Ohio abortion law would be one of strictest in country†. Wews Newsnet5.com. 8 Feb. 2011. 28 Mar. 2011.

Law of Trusts Essay Example | Topics and Well Written Essays - 2000 words

Law of Trusts - Essay Example her well-disposed persons, some for the relief of aged and poor persons, some for the maintenance of sick and maimed soldiers and mariners, schools of learning, free schools and scholars in universities, some for repair of bridges, ports, causeways, churches, sea-banks and highways, some for education and preferment of orphans, some for or towards relief or maintenance of houses of correction, some for marriages of poor maids, some for aid and help of young tradesmen, which lands, goods (and) money have not been employed according to the charitable intent of the givers and founders thereof, by reason of frauds, breach of trust and negligence in those that should pay (and) deliver same.† "Charity in its legal sense comprises four principal divisions: trusts for the relief of poverty, trust for the advancement of education, trusts for the advancement of religion, and trusts for other purposes beneficial to the community, not falling under any of the preceding heads." In this essay, I would like to establish that the concepts of charities is still very much relevant to our present society as the four heads mentioned in the Pemsel case is still very much relevant to the present times. In some countries that adopted the preamble3, they expand the law to include such other groups and entities, which may need the assistance afforded by the Statutes. However, the Statutes of Charitable Uses is self-limiting and there is need to expand the coverage thereof in response to modern times. Thus, the concept of Charities evolved into the new Charities Bill. In order to understand better this evolution of the application of the law, let us look at the four areas covered by the Elizabethan law and see how this concepts have evolved over time4 and how our case law affected the evolution thereof. Relief of poverty is one of the noblest tasks of mankind to help each other. Under the Elizabethan law, there were two forms of relief, which was set up, one is the outdoor relief5 and

Legal Requirements for Employee Benefits Essay Example for Free

Legal Requirements for Employee Benefits Essay As we discussed earlier in this chapter, some benefits are required by law. This requirement adds to the cost of compensating employees. Organizations looking for ways to control staffing costs may look for ways to structure the workforce so as to minimize the expense of benefits. They may require overtime rather than adding new employee, hire part-time rather than full-time workers(because part-time employees generally receive much smaller benefits packages),and use independent contractors rather than hire employees. Some of these choices are limited by legal equirements, however. For example ,the Fair Labor Standards Act requires overtime pay for nonexempt workers, as discussed in chapter 11. Also,the Internal Revenue Service strictly limits the definition of independent contractors,â€Å" so that employees cannot avoid legal obligations by classifying workers as self-employed when the organization receives the benefits of a permanent employee . Other legal requirements involve tax treatment of benefits ,antidiscrimination laws, and accounting for benefits. Tax treatment of benefits A modern, flexible benefit plan provides a number of potential tax advantages to employees and employers. Employees A flexible benefit plan allows employees to choose to swap some of their existing benefits or purchase benefits from a menu of options. Payments in excess of the employees spending allowance are normally collected via a gross salary adjustment. If employees exchange salary for tax exempt benefits (pensions, life cover, childcare vouchers, mobile phones, etc. ), they do not pay tax or National Insurance on the amount exchanged. This gives a basic rate tax payer earning less than the National Insurance (NI) Upper Earnings Limit (UEL) a saving of 33% compared to receiving the money as salary. For example, an employee that exchanges ? 200 per month of their salary for childcare vouchers and additional pension payments will save ? 792 in tax and NI compared to taking the money as salary. Even if the benefits are not tax exempt, employees can still exchange salary for employer provided benefits and, whilst they will be charged income tax, they save NI as their salaries have been reduced by the value of the benefit. This gives employees earning under the UEL an 11% saving. Employers Employers participating in a flexible benefit plan do not pay employers NI on payments on payments to exempt benefits. If these payments have been exchanged from salary by employees then the employer will save 12. 8% employers NI on the amounts. For example, an employee that exchanges ? 200 per month of their salary for childcare vouchers and additional pension payments will deliver an annual NI saving to the employer of ? 307. Antidiscrimination Laws  Legal treatment of men and woman includes equal access to benefits, so the organization may not use the employee’s gender as the basic for providing more limited benefits. That is the rationale for the Pregnancy Discrimination Act, which requires that employers treat pregnancy or childbirth, the employee needs time off for conditions related to pregnancy or childbirth, the employee would receive whatever disability benefits the organization offers to employees who take disability leave for other reasons. Another area of concern in the treatment of male and female employees is pension benefits. On average, woman live longer than men, so on average, pension benefits for female employees are more expensive (because the organization pays the pension longer), other things being equal. Some organizations have used this difference as a basis for requiring that female employees contribute more than male employees as a basis for requiring that female employees contribute more than male employees to defined benefit plans. The Supreme Court in 1978 determined that such a requirement is illegal. According to the Supreme Court, the law is intended to protect individuals, and when women are considered on an individual basis ( not as averages ), not every woman outlives every man. Age discrimination is also relevant to benefits policies. Two major issues have received attention under the Age Discrimination in Employment Act (ADEA) and amendments. First, employers must take care not to discriminate against workers over age 40 in providing pay or benefits. For example, employers may not set an age at which retirement benefits stop growing as a way to pressure older workers to retire. Also, early retirement incentive programs need to meet certain standards. The programs may not coerce employees to retire, they must provide accurate information about the options available, and they must give employees enough time to make a decision. In effect, employees must really have a choice about whether they retire. When employers offer early retirement, they often ask employees to sign waivers saying they will not pursue claims under the ADEA. The Older Workers Benefit Protection Act of 1990 set guidelines for using these waivers. The waivers must be voluntary and understandable to the employee and employer , and they must spell out the employees rights under the ADEA. Also , in exchange for signing the waiver, the employee must receive â€Å"compensation† that is , greater benefits than he or she would otherwise receive upon retirement. The employer inform employee that they may consult a lawyer before signing, and employee must have time to make a decision about signing-21 days before signing plus 7 days afterward in which they can revoke the agreement. The Americans with Disabilities Act imposes requirements related to health insurance. Under the ADA, employees with disabilities must have equal access to whatever health insurance coverage the employer provides other employees. Even so, the terms and conditions of health insurance may be based on risk factors -as long as the employer does not use this basis as a way to escape offering health insurance to someone with a disability. From the standpoint of avoiding legal challenges, an employer who has risk-based insurance and then hires an employee with a disability is in a stronger position than an employer who switches to a risk-based policy after hiring a disabled employee. Accounting Requirements Companies financial statement must meet the many requirements of the Financial Accounting standards Board ( FASB) . These accounting requirements are intended to ensure that financial statements are a true picture of the companys financial status and that outsiders, including potential lenders and investors , can understand and compare financial statements . Under FASB standards, employers must set aside the funds they expect to need for benefits to be paid after retirement, rather than funding those benefits on a pay-as-you-go basis. On financial statement, those funds must appear as future cost obligations. For companies with substantial retirement benefits, reporting those benefits as future cost obligations greatly lowers income each year. Along with rising benefits costs. This reporting requirement has encouraged many companies to scale benefits to retirees. Summarize the regulation affecting how employers design and administer benefits program. Employers must provide the benefits that are required by law, and they may not improperly classify employees as independent contractors to avoid paying benefits. Tax treatment of qualified plans is favorable, so organizations need to learn the requirements for setting up benefits as qualified plans-for example, ensuring that pension plans do not discriminate in favor of the organizations highly compensated employees. Employers may not use employees gender as the basis for discriminating against anyone, as in pension benefits on the basis that women as a group may live longer. Nor may employers discriminate against workers over age 40 in providing pay or benefits, such as pressuring older workers to retire by limiting retirement benefits When employers offer early retirement, they must meet the requirements of the Older Workers Benefit Protection Act of 1990. Under the Americans with Disabilities Act, employers must give disabled employees equal access to health insurance. To meet the requirements of the Financial Accounting Standards Board, employers must set aside the funds they expect to need for retirement benefits ahead of time, rather than funding the benefits on a pay-as-you-go basis

Turkey Vultures :: essays research papers

Turkey Vultures   Ã‚  Ã‚  Ã‚  Ã‚  Vultures are large birds of prey closely related to hawks and eagles. They are divided into New World vultures and Old World vultures, both belonging to the order Falconiformes. The New World vultures, in the family Cathartidae, consist of seven species in five genera. Among the New World vultures include the Cathartes aura, also known as the Turkey Vulture.   Ã‚  Ã‚  Ã‚  Ã‚  Scientists say that turkey vultures are shy, inoffensive birds. Some researchers have discovered that the bird is very helpful to the environment. Its habit of cleaning up decaying and diseased carcasses makes it a sanitary engineer par excellence, while its keen sense of smell has been pressed into service to find wasteful and dangerous gas leaks. And the vulture’s unique knack for conserving energy has intrigued scientists for years.   Ã‚  Ã‚  Ã‚  Ã‚  Although the turkey vulture has a large, turkeylike body and sporty red head, it is not even distantly related to the turkey. Instead, turkey vultures- along with their cousins in the United States, the black vulture of the South and East, and the nearly extinct California condor-belong to a group of raptors called New World vultures. Chromosome analysis shows that the New World vultures are actually more closely related to storks than to the vultures of Europe, Asia, and Africa.   Ã‚  Ã‚  Ã‚  Ã‚  Turkey vultures are remarkably successful birds. They range everywhere from parts of Canada and much of the United States to South America. At home in deserts, prairies and woodlands, they have even settled close to people in a number of urban and suburban areas.   Ã‚  Ã‚  Ã‚  Ã‚  Observed in flight, the turkey vulture appears black with the underside of its wings grayish or silvery, giving the birds a two-toned appearance. They characteristically hold their wings in a slight V, or dihedral, thus aiding identification. On rare occasions, they hold their wings flat and eagle-like which, if seen at a great distance, may cause the birds to resemble eagles. In flight, the turkey vulture holds it’s naked head, crimson-red as adults and grayish-black as immatures, downward in contrast to eagles, which hold their heads forward.   Ã‚  Ã‚  Ã‚  Ã‚  The tail of the turkey vulture extends far beyond the rear edge of its wings. They typically rock or tilt from side to side while gliding or soaring on updrafts or circling overhead. Their occasional wingbeats are powerful and labored. Turkey vultures are large birds with wingspreads of about six feet. Their wings are long, moderatly wide, and have strongly slotted tips. Typically, the wings are held slightly above a horizontal plane when the bird is aloft. This forms a characteristic dihedral which is very useful in making correct field identification. Although turkey vultures use thermals, they are more

Emmett Till

Makayla Richards Mrs. Bonham Literature 101 5 March 2013 Emmett Till Research Paper Three Major Points: Lynching, Mississippi Trial, 1955 Thesis Statement: The murder of Emmitt Till was a murder that changed America The Emmett Till Case, 1955 Chilling Circumstances The story surrounding the death of Emmett Till provides chilling insight into the racism that dominated the South in the 1950s. Emmett was a fourteen-year-old Chicago native visiting his relatives in Mississippi.While out with his cousins and friends on the night of August 24, 1955 he allegedly whistled at a white woman in the grocery store owned by her husband. Stories vary as to what Till actually said or did. According to the woman Till grabbed her and made rude remarks. Some witnesses claimed that he only whistled at her. Still others assured that he made no problems at all, that he whistled continuously to control a speech defect. A Brutal Murder Roy Bryant considered his wife's life ruined by the incident. Several ni ghts after the episode, Bryant, his half brother J. W.Milam, and possibly others kidnapped Emmett from his relatives' house in the middle of the night. The two men beat him severely and, apparently saw that he had a picture of a white woman in his wallet, they shot Emmett and threw him in a nearby river. Several days later the body was found, and Bryant and Milam were charged with murder. A Surprise Verdict Mississippi politicians and newspapers condemned the murderers and promised justice. However, Mississippians became more defensive as the weeks passed. The Press attacked them with harsh judgment of racial violence in the South.The highly publicized trial of the two men was charged with racial tension. African-American politicians and reporters from the North were treated horribly and were segregated in the courtroom. The prosecution was poorly prepared, and the substance of the defense was the shocking claim that Till was not actually dead. The Killers Tell the Truth The truth o f what happened that night became public knowledge several months after the trial. William Bradford Huie, an Alabama journalist in Mississippi to report on the aftermath of the case, offered Bryant and Milam money to tell their story.Since the two could no longer be prosecuted for a crime of which they had already been accused of, they gladly told for a fee of how they had beaten and killed young Emmett Till. Huie reported what the killers told him in the January 24, 1956 issue of  Look magazine. Now publicly exposed as murderers, Bryant and Milam were shunned by the community, and both moved elsewhere within a year. Emmett Till in death became a saint for the civil rights movement, a symbol of the racial hatred African-Americans who had yet to overcome the situation.Citations: MLA Citation â€Å"Emmett Till†. Anti Essays. 23 Mar. 2013 APA Citation Emmett Till. Anti Essays. Retrieved March 23, 2013, from the World Wide Web: Source Citation:  Ã¢â‚¬Å"The Emmitt Till Case, 1 955. †Ã‚  Discovering U. S. History. Gale Research, 1997. Reproduced in Discovering Collection. Farmington Hills, Mich. : Gale Group. October, 2001. Stephen J. Whitfield,  A Death in the Delta: The Story of Emmett Till  (New York: Free Press, 1988). Source Database:  Discovering U. S. History

Project management email Essay

Our team has done the required analysis based on the information that was given to us. We would like to recommend the Piper Industries Corp. to pursue with the project Palomino for future investments. We arrived at this conclusion based on the risks involved, feasibility study, break even analysis and return on the investment studies. It has been stated as a requirement that the project has to be finished and it should start generating revenue within the next 12 months. Below you will find a detail description of the different phases of a project and then an analysis on all three projects, followed by our recommendation. Phases of a project From the start to finish a project can be divided into five different phases (http://www.projectinsight.net/project-management-basics/basic-project-management-phases). Project conception and initiation The purpose of this phase is to define the project accomplishments. This is a critical phase as it is essential for those who will deliver the product/service, for those who will use the product/service, and for those who have a stake in the project to reach agreement on its initiation (http://pmstats.dis.arkansas.gov/Meth/05-Initiation%20phase.pdf). During this phase, the idea of the project is analyzed to see how beneficial it is to the business. Project definition and planning This phase defines the project scope and its activities. It outlines the tasks that have to be performed to complete the project. During this phase, a team should prioritize the project, calculate a budget and schedule, and determine what resources are needed (http://www.projectinsight.net/project-management-basics/basic-project-management-phases). Project launch or execution During this phase, the defined project activities are started to be executed. The project manager moves his attention from planning to execution. A constant monitoring of project risks is required during this phase. There will be a daily interaction between the team members, to successfully finish the execution tasks. Project performance and control Progression of the project is measured during this phase. The current status of the project will be compared with the actual plan. Scope verification and control to check and monitor for scope creep, change control to track and manage changes to project requirement, calculating key performance indicators for cost and time are to measure the degree of variation if any and in which case corrective measures are determined and suggested to keep project on track (http://project-management.com/top-5-project-management-phases/). Project closure During this phase the project tasks are satisfactorily completed and tested, the client approves the project. The project team evaluates success or failure of the project and documents key learning’s, to implement in future projects. This phase also involves in relieving project resources, reward and recognizes team members and formal termination of contractors in case they were employed on the project (http://project-management.com/top-5-project-management-phases/). Analysis of the proposed project Risk of project completion assessment Based on the risk of completion assessment, Juniper has the lowest impact, Stargazer the highest and Palomino has the medium risk of finishing the project on time. The critical path is known in both Juniper and Palomino, whereas there is no indication of critical path in Stargazer. The notes also say that there are still open questions from the business on Stargazer, which increases the risk of completing the project on time. The basic requirement from the management is that the project should be completed and generating revenue in 12 months. On this basis, it is better for the company to choose either Palomino or Juniper. Delivery Dates based on the assumption that the project starts on January 1st 2015 Juniper: June 31st 2015 Palomino: September 31st 2015 Stargazer: Unknown ROI assessment and break even analysis For Juniper the return on investment is $250,000 yearly for the next two to three years, which could provide $500,000 to $750,000. The cost of doing the project is $325,000. So the project breakeven point is within 2 years. For Palomino, the ROI is $450,000 yearly for the next five years, which will result in $2,250,000. The cost of doing this project is $655,000. Even with the 5% margin of error, the breakeven for this project is within 2 years. For Stargazer, the ROI is, $1,600,000 ($300,000 first year; $550,000 the second year; and $750,000 the third year). There is no information on the ROI for the rest of the years. So there is an unknown factor involved in this project. The cost of this project is $1,025,000 ($450,000 + $575,000). The breakeven for this project is within 3 years. Based on this assessment, the breakeven point is lesser if the company pursues Juniper or Palomino. Product lifecycle Juniper’s product has only 3 years of life cycle, while both Stargazer and Palomino has 7 years of product life. Based on this assessment, the company will profit if it chooses Stargazer or Palomino. Feasibility Analysis A feasibility assessment is the disciplined and documented process of thinking through an idea from its logical beginning to its logical end (http://www.agmrc.org/business_development/starting_a_business/marketbusiness_assessment/articles/assessing-the-feasibility-of-businesspropositions/). With Juniper project, the product is feasible, as we can predict the forecasting of its schedule. It starts to generate profit within 12 months. But since the product life span is less, the company’s profit ends soon. Stargazer, even though it is an innovative product it is risky and it has unanswered business questions, so it may not be feasible to complete the project on time. Its forecasting variance is very high. Even though a sunk cost of $450,000 is involved in this project, there is no guarantee for the product to start generating returns in 12 months if we pursue this project. In Palomino project, the risk is medium and the critical path is known. Recommendation: Even though Palomino has a 5% margin of error from its supplier, we conclude that this project is more feasible and profitable than the other two.

Staffing Example

Staffing Example Staffing – Coursework Example Structured interview form for World Bank World Bank is a United Nations branch; it is in United s, Washington. It was started in 1944 with an aim to reduce poverty in developing countries. It provides loans and financial assistance to membered countries all over the world. In this question, have decided to be a Human Resources Manager of the World Bank, by conducting an interview of recruiting employees to work in different departments in the Bank. The interview will be tight because the number of interviewees is high. Interviewing is the best way to recruit employees, because it completely assesses the interviewee knowledge and interpersonal skills. Tell us what you understand about World BankThe answer to this question helps to evaluate the experience of the interviewee about the bank. It helps to identify if he/she has self-interest in the bank and if they know what they will be doing in the bank. They know roughly about the activities conducted in the bank, the purpose of the ban k, its strengths and weaknesses. It will help to identify the most serious interviewees in the interview and those who have attended just for the sake of attending.How can you handle a misbehaving client in your office?This question identifies the performance of the interviewee and his customer service skills. Their attitude concerning a problem with their clients and how they can best solve it. The performance matters in any business because it also depicts on how the interviewee will be relating with the other workers and the top management. Good behavior is a crucial component in an interview. Do you have any cash handling experience?This question will assess how the interviewee can handle much cash that is flowing in his day to day activities. It looks at the transparency of the individual to handling cash if he/she knows how to record balance sheets and other cash flow documents, how to best avoid stealing money or the disappearance of money with no exact source.Tell us more ab out the banking law amendment billThis question helps to know if the interviewee knows more about the current affairs concerning the banking sector, what change have been made lately, the performance of other banks, the importance of listening to the news and reading some banking journals.What do you understand by the term depositing, withdrawing, cheque and bank slips?This question helps to identify if the interviewee knows some basic terms of the banks. It helps to avoid misunderstanding or poor performance skills of the worker. This question helps to identify the education and experience level of the interviewee. General knowledge about the subject in which one will be interviewed.In summary, interviews are important in recruiting of employees because they help to assess the information and performance skills of the employees. It will help to counter any work related problems after recruiting employees.ReferenceMargret, D., (2006), The Essential Guide to Recruitment: How to Condu ct Great Interviews and Select the Best Employees. London: Kogan Page Publishers

Pro Forma Sessions in Congress

Pro Forma Sessions in Congress In the daily agendas of the House of Representatives and Senate, you will often see that House or Senate leaders have scheduled a â€Å"pro forma† session for the day. What is a pro forma session, what is its purpose, and why do they sometimes stir up political firestorms? Key Takeaways: Pro Forma Sessions Pro forma sessions are meetings of the U.S. Congress held â€Å"in form only.† Either house of Congress can hold pro forma sessions.During pro forma sessions, no votes are taken and no other legislative business is conducted.Pro forma sessions are held for the purpose of meeting the â€Å"three-day rule† in Article I, Section 5 of the U.S. Constitution. The three day rule prohibits either chamber of Congress from not meeting for more than three consecutive calendar days during a congressional session without the approval of the other chamber. The term pro forma is a Latin term meaning â€Å"as a matter of form† or â€Å"for the sake of form.† While either chamber of Congress can hold them, pro forma sessions are most often held in the Senate. Typically, no legislative business, such as the introduction or debate on bills or resolutions, is conducted during a pro forma session. As a result, pro forma sessions rarely last more than a few minutes from gavel-to-gavel. There are no constitutional restrictions on how long pro forma sessions must last or what business may be conducted in them. While any Senator or Representative present can open and preside over a pro forma session, the attendance of other members is not required. Indeed, most pro forma sessions are conducted before nearly empty chambers of Congress.   A Senator or Representative from one of the nearby states of Virginia, Maryland or Delaware is usually chosen to preside over pro forma sessions since members from other states have usually left Washington, D.C. for vacations or meeting with constituents in their home districts or states. The Official Purpose of Pro Forma Sessions The officially stated purpose for pro forma sessions is to comply with Article I, Section 5 of the Constitution, which prohibits either chamber of Congress from adjourning for more than three consecutive calendar days without the consent of the other chamber. Scheduled long-term breaks provided for in the annual legislative calendars for  sessions of Congress, such as the summer breaks and district work periods are typically provided for by the passage in both chambers of a joint resolution declaring the adjournment. However, the numerous unofficial reason for holding pro forma sessions of Congress often results in controversy and politically hurt feelings. The More Controversial Purpose of Pro Forma Sessions While doing so never fails to raise controversy, the minority party in the Senate often holds pro forma sessions specifically to prevent the President of the United States from making â€Å"recess appointments† of persons to fill vacancies in federal offices that require the approval of the Senate. The president is allowed under Article II, Section 2  of the Constitution to make recess appointments during recesses or adjournments of Congress. Persons appointed by recess appointments assume their position without the approval of the Senate but must be confirmed by the Senate before the end of the next session of Congress, or when the position again becomes vacant. As long as the Senate meets in pro forma sessions, Congress never officially adjourns, thus blocking the president from making recess appointments. However, in 2012, President Barak Obama made four recess appointments during Congress’ winter break, despite a run of daily pro forma sessions called by Senate Republicans. Obama argued at the time that pro forma sessions do not block the president’s â€Å"constitutional authority† to make appointments. Despite being challenged by Republicans, Obama’s recess appointees were eventually confirmed by the Democrat-controlled Senate.

South Asian Art Essay Example | Topics and Well Written Essays - 500 words

South Asian Art - Essay Example As with other figures of Buddha, The Head of Buddha features lakshanas to portray that he is the Enlightened One. The Buddha's bulge on his head signifies his "transcendent knowledge" and excellent mental capacity. It should also be noted that Buddha has long empty ears as he formerly wore big, heavy goal earrings as a prince. However, as he accepted pain and suffering, he took off his power and riches including his royal garment and earrings to be freed from material wealth (Kossak and Watts 27). The Head of Buddha's gesture also shows one important quality of Buddha. We can see that the eyes of Buddha are half-closed signifying that he is very peaceful and quiet. The artist used this gesture to depict this deep contentment in life. The figure shows the image of another reincarnation of the Great Goddess Devi. In Hindu mythology, Parvati is the reincarnation of Sita who killed herself "because of an insult to her husband" (Kossak & Watts 30). Parvati's image in the sculpture, both in shape and in gesture, symbolizes what she came here for-"lure the mourning Shiva to other marriage" (Kossak & Watts 30). Parvati is depicted as very alluring with huge breasts and small waist. Parvati, thus, became a symbol for "fertility, marital felicity, devotion to spouse, asceticism, and power" (Parvati 2).

The system of Assessing for Elementary School Essay

The system of Assessing for Elementary School - Essay Example This was treated as a successful method to make them enjoy the essence of the classroom. One more thing is that children are attracted towards colors, so they take special attention in listening, and even those who do not pay attention will try to concentrate a little than what they had been doing before.Recommendations for the pictographic test:1. It should be noted particularly that a classroom is composed of all levels of students starting from dull to brilliant students, so any system, for instance, should be implemented with the notion to improve the quality of learning of all levels of students. In the case of dull students, the standard of understanding and remembering becomes quiet doubtful.Because not all the dull students will have benefits from this method. 2. The teacher should concentrate more on the performance of dull students than those who show considerable improvement.3. The choice of colors could be more of a bright nature.4. When the teacher asks the question in t erms of showing a picture and guessing, he or she should come voluntarily and help the students till they get accustomed to this method.5. This method could also be applied while conducting tests for higher class students but they should be given a partial picture so as to enhance their reasoning power and ideas.6. Finally, if a student fails even in this method the teacher should find out the spot where the student has the difficulty. Because while analyzing this test method it is comparatively an easy one to understand the lessons.

Compare and Contrast Army Ground Fleet Maintenance with Civilian Research Paper

Compare and Contrast Army Ground Fleet Maintenance with Civilian Ground Fleet Maintenance - Research Paper Example Civilian institutions conduct business with the aim of profit making while US Army is a non-profit generating government function. This causes both similarities and differences in terms of activities performed in their respective fleet management systems. Below is a comparison and contrast between the two institutions. There is a couple of differences between the U.S. Army Ground Fleet Maintenance activities and the Civilian Ground Fleet Maintenance activities of organizations such as Coca Cola, Pepsi, etc. Some of these differences stem from a legal perspective while others stem from operation activities undertaken in the military bases. Some of the notable differences include; the military outsources its fleet management function to the industry including even tactical vehicles used by the military. For instance, the military in made a decision to outsource its fleet of M109 vehicles family (Paladin) that encompasses the M109 self-propelled howitzer & the M992 field vehicles supplying artillery ammunition under the fleet management program (NDIA Staff, 1999). Further, under the same program, the manager is responsible all resources of technical nature ranging from field maintenance to training hence making him responsible for the entire spare parts modernization, while soldiers control the daily maintenance activities. On the other hand, in the Civilian Ground Fleet Maintenance activities, outsourcing of the fleet management program is restricted to the organizations’ departments mandated to control and manage the company fleets, especially the transport department. For instance, unlike in the military where the function of outsourcing of maintenance services is a policy, in Civilian organization outsourcing of the maintenance activities is done in-house by the organizations workers e.g. in the case of Coca-Cola. Therefore, unlike in the military, Ground Fleet Maintenance activities are accomplished

Characterisation of Prostate Cancer Stem Cells

Characterisation of Prostate Cancer Stem Cells Abstract Background Advances in the study of cancer cells with stem cell characteristics may enable the development of new and improved cancer therapies. Stem cell marker expression can be investigated by QPCR and this sensitive method has been used to characterise prostate cancer stem cells. Methods Prostate cancer cell lines LNCaP and C42B were grown under adherent and nonadherent culture conditions. Non-adherent culture generated prostaspheres that are enriched in stem cells. In addition, LNCaP and C42B prostaspheres were treated with Wnt3a. RNA was extracted from both adherent and prostasphere cultures of LNCaP and C42B cells. cDNA was synthesized and QPCR analysis was performed with TaqMan probes in order to examine the expression of 10 genes: Nestin, Oct4, Sca-1, BMI-1, PSA, NSE,CD44, K18, ABCG2 and c-kit. Results Prostasphere culture caused a dramatic increase in the relative expression of ABCG2 and Keratin 18 in both cell types. Conclusion The findings suggest ABCG2 may be a valuable marker for identification of prostate cancer cells with stem cell characteristics. Moreover this technique of Q-PCR may prove to be a sensitive method of evaluating markers in cancer patients. Introduction Prostate cancer is commonly diagnosed in males over 60 and is the second most common cause of cancer death in UK in men, after lung cancer (1). Following diagnosis, prostate cancer is categorised in low risk, intermediate risk and high risk. For low risk cases treatment is usually under active surveillance while intermediate and high risk is treated by surgery and radiation. Advanced cases (presence of metastasis) treatment is by androgen ablation and it almost always produces objective clinical responses (2). However, in most patients there is relapse with the development of androgen independent prostate cancer, which is associated with a median survival, of 20–24 months (3). Currently, androgen independent metastatic prostate cancer is treated by Docetaxel an anti-mitotic that extends life by an average of 3 months (3). Although, the mechanisms of prostate cancer development and progression have been extensively studied this process is not fully understood. Several genes including MYC and PTEN have been linked to the development of prostate cancer (28). However, one of the most important discoveries in the genetics of prostate cancer is the identification of TMPRSS2-ETS fusion protein that arises as a result of a genetic translocation (4). TMPRSS2 is androgen-regulated transmembrane serine proteases secreted by normal prostatic tissue and an increase in androgen level increases TMPRSS2 expression. ETS family transcription factor (ERG, ETV1, or ETV4) targets genes involved in cell transformation, growth and apoptosis. Therefore fusion of TMPRSS2 gene promoter with one of the member of ETS family results in positive dysregulation of the ETS gene. TMPRSS2-ETS fusion proteins have been speculated to play a role in the development of up to 50% of prostate cancers but not the progression to androgen independence (4). Androgen independent prostate cancer has been postulated to arise as a consequence of increase activity of the androgen receptor (AR), altered cell signalling pathways, or the survival and proliferation of prostate cancer stem cells. Recent papers have conceptualized that cancer can arise from cancer cells with the characteristics of stem cells, unlimited self-renewal and the ability to produce differentiated daughter cells (5). These cells have been termed cancer stem cells (10) and may promote tumour growth, metastasis and relapses, thus having a huge impact on patient survival. The cancer stem cell model hypothesis is that cells with stem cell characteristics accumulate genetic changes over long period of time, escape the environmental control and give rise to cancerous growth. There is good evidence that cancer stem cells cause leukaemias and it has also reported that cancer stem cells can contribute to solid tumour development in brain, breast, colon and prostate. As prostate cancer is a heterogenic disease, several distinct cancer stem cell populations maybe present in a tumour (5). On basis of this knowledge, the role of cancer stem cell is been explored in solid tumours. For instance in prostate cancer mutation of the androgen receptor may result in the growth of tumour that can sustain androgen deprivation or very low level of androgen or use alternative pathways involving growth factors and cytokines. Recent studies (6) have also identified mammary stem cells as being a potential source of breast cancer, tumour relapse and tumour metastasis. For this reason it is vital to understand the stages of cell differentiation in normal prostate epithelium and identification of cells that are involved in prostate carcinogenesis and androgen independent prostate cancer. The prostate is a glandular organ comprising of three distinct epithelial cell populations that may contribute to tumorigenesis (7). Each prostatic duct is lined by nonsecretory basal cells which form a layer along the basement membrane (figure 1). Luminal cells are the major secretory cell, producing 30% of seminal fluid components and lining the lumen of duct and acini. These luminal cells are highly differentiated and expresses prostate specific antigen, cytokeratin 8 and 18 and the nuclear androgen receptor (27). Neuroendocrine cells are also present along the basement membrane and secrete neuroendocrine peptides that support epithelial growth and viability. Vascular components and stromal endothelial cells are also present in the gland. Figure 1. Schematic presentation of the cell types within a human prostatic duct. (Adapted from Abate-Shen, C. Shen, M et al 2000) Recent evidence has suggested stem cells are also present within the prostate cancer cell population. It have been theorized that stem cells may lie in the basal layer of prostate in man and in the basal and luminal compartments in mice (19). A transient amplifying population of daughter cells arises from these stem cells and generates differentiated PSA producing cells in man. Stem cells can have different characteristics, including resistance to apoptosis and increased expression of multidrug resistant transporters (8, 23, 24, 25 ). The findings of Collins et al 2001 (9) revealed that stem cells can be distinguished from the transient amplifying cells and showed there is 2-3 fold increases in expression of surface level of integrin ÃŽ ±2ÃŽ ²1. Figure 2. Hypothetical model of stem cells showing normal prostate development and prostate cancer (De Marzo MA et al 1998). De Marzo MA et al 1998 in his paper states pluripotent stem cells are capable of differentiation and self-renewal and is present in the basal epithelium of the prostate, which contains cytokeratin 5 and 14 expressing cells (figure 2). Intermediate progenitor populations located within the basal epithelium expresses both basal and secretory cell characteristics (11). Intermediate cells with limited proliferative capacity can differentiate into mature secretory luminal (androgen receptor positive) or neuroendocrine cells which are non-proliferative. In prostate cancer, it is proposed that transformation occurs which leads to the proliferation of cells with stem cell characteristics and the production of an excess of cells with luminal characteristics (Bisson and Prowse 2009). Normal murine prostate stem cells have been functionally identified by their ability to form prostate spheres (13) and to form differentiated prostate tubular structures when returned to an in vivo environment (13, 14). The in vivo generation of prostate structures from normal human prostate cells in xenograft studies and the ability to isolate a human basal prostate cell population with enriched capacity for prolonged clonal expansion and luminal differentiation have led to the hypothesis that normal human prostate stem cells are located within the basal layer of the gland (15-18). English HF et al 1987 (19) in an experiment found following androgen ablation of rodent prostate glands the stem cells exhibited regenerative properties especially of the secretory cells indicating these cells are self- sustainable, which supports the hypothesis that stem cells reside within the basal layer of the gland and are able to survive in absence of androgen environment. These cells may also therefore have the ability to survive androgen deprivation therapy and contribute to the development of metastatic prostate cancer. At present proper characterization of stem cells has been limited by the absence of specific markers that distinguishes stem cells from their more differentiated progeny. Gene expression and microarray profiling may be able to identify specific markers. These markers may also be prognostic for patient response to therapy and survival. Past papers have discussed non-adherent culture media techniques to isolate neuronal, colon and breast cancer cells that exhibited stem cell characteristics. In a recent paper by Bisson and Prowse et al 2009 (10) the authors studied prostate cancer cell lines (22RV1, DU145, PC3, VCaP, LNCaP and the LNCaP subline C4-2B) and were able to form prostosphere in non adherent culture conditions. Prostosphere were able to form from both AR positive (LNCaP, VCaP, 22RV1) and AR negative (PC-3, DU145) cell lines. Analysis of marker protein expression of proliferation (ki67) and differentiation (keratin 18 and PSA) of prostosphere revealed that cell heterogenecity existed within the prostaspheres, which may be due to different percentages of stem cells within the cell lines or maybe related to adaptation to their environment in the nonadherent culture conditions. Immunoflourescence (Figure 4) of these prostospheres with stem cells associated markers (CD44, CD133, ABCG2) showed increase in expression compared with the adherent cultures, consistent with enrichment for stem cells. However this analysis was only performed by immunofluorescence, and was limited by the semi-quantifiable nature of this technique and the antibodies available (10). Aim Quantitative analysis of cells with stem like characteristics in prostate cancer has not been attempted yet. The aim of my project is therefore, quantitative PCR (QPCR) analysis of stem cells associated gene expression of the prostosphere compared to that of the adherent culture. Material and Methods For my project I used the prostate cancer cell lines DU145, LNCaP and the LNCaP subline C4-2B. The prostasphere formation (P0) is highest in the cell types of LNCaP and its androgen independent derivative C42B, which both express AR and PSA (23). I conducted my experiments by real time PCR to measure the mRNA level of expression on cDNA extracted from prostasphere of LNCaP and subline of LNCaP, C42B cell line. This assay is both qualitative and quantitative and allowed me to compare the RNA gene expression in relation to the control (GAPDH). However there are certain limitations of using this method in my experiment. The prostasphere is heterogenic and the stem cell population within probably only a small fraction of the cells. Therefore it will be interesting to see how this affects the gene expression of the mRNAs. Cell Culture Prostate cancer cell lines LNCaP, C42B and DU145 were cultured at 37 °C in RPMI using 10% fetal bovine serum (Invitrogen), 2.4 mM glutamine (Sigma-Aldrich), 1% (v/v) pyruvate (Sigma-Aldrich), penicillin and streptomycin (50 U and 50 ÃŽ ¼g/ml) (Invitrogen). Trypsin (Sigma-Aldrich) was used to detach adherent cells, prior to cell counting, passage or analysis (10). Prostasphere cultures were established on low attachment 6-well plate (Costar) when single cells were plated in DMEM/F12 (Invitrogen) supplemented with B27 and N2 (Invitrogen) and grown under these conditions for 6-12 days (Bisson and Prowse 2009). These proliferating spheres of cells are enriched for stem cells (Bisson and Prowse 2009) and were prepared for these experiments by Dr Prowse. The prostasphere medium was also supplemented with WNT3a at 20 µg/ml (RD Systems) and the Hedgehog pathway inhibitor cyclopamine for 6 days prior to analysis. RNA Extraction RNA was extracted from prostate cancer cell lines LNCaP, C42B and DU145 cells (stored at -70 °C and thawed at 37 °c before extraction) using RNeasy Kit (Superscript II enzyme and Poly-A primer) from Qiagen. 600 µl of RLT Plus (10 µl of ÃŽ ²-mercaptoethanol was added to 1ml of RLT Plus buffer prior to the experiment) was added to the cells. The lysate was then added to the QIAshredder spin column sitting on a 2ml eppendorf and centrifuged for 2 minutes at maximum speed (14000 x g). The flow through was transferred to another tube and an equal volume of 70% ethanol was added and mixed by pipetting several times. 700 µl of the samples was added to a RNeasy spin column and centrifuged for 15 secs for 14000 x g. The flow through was discarded and 700  µl of buffer RW1 (supplied) was added to the spin columns and centrifuged for 15 secs at 14000 x g. The flow through was discarded and the column was placed on a new collection tube. 500  µl of buffer RPE was added to the column and centrifuged for 2 minutes to dry the RNeasy membrane. To further dry the membrane the column was placed on another tube and centrifuged at maximum speed for one minute to completely dry the column and to remove the trace of RPE buffer. The column was then transferred to another collection tube and 30  µl of RNAse free water was added. Finally the tube was centrifuged for one minute (14000 x g) and the elute collected. The RNA was stored at -80 °C freezer (detailed protocol attached in Appendix). Reverse transcription c-DNA synthesis was done by using SuperscriptTM III First-Strand Synthesis System for RT-PCR. According to the manufacturer’s instruction 2  µl (2  µg) of previously prepared RNA was added to 1 µl of 50uM oligo (dT)20, 1 µl of 10mM dNTP mix in a tube and DEPC-treated water added to make a volume of 10  µl. The reaction tube was incubated at 65 °C for 5 mins and then placed on ice for one min. In another tube 2  µl of 10X RT buffer, 4 µl of 25mM Mgcl2, 2  µl of 0.1DTT, 1  µl of RNaseOUTTM (40U/  µl) and 1  µl of SuperScriptTM III RT (200 U/  µl) was added. The 10  µl mix of the first tube was added to the second tube and incubated for 50 mins at 50 °C. The reaction was terminated by incubating at 85 °C for 5mins and then chilled on ice. 1  µl of RNase H was added to the tube and incubated for 20 mins at 37 °C. The total yield of cDNA was 25  µl and this was stored at -20 °C till further use. Polymerase Chain reaction Polymerase chain reaction was carried out on the cDNA synthesized, using GREX-f* primer GAGTACCTCTGGAGGACAGA and GRINTRON-r* primer ATGCCATTCTTAAGAAACAGGA. For each reaction 5  µl of 10xPCR buffer II, 3 or 6  µl of 25mM MgCl2, 4  µl of 10mM dNTP, 1  µl of forward and reverse primer at 10  µM and 0.25  µl of AmpliTaq Gold Enzyme were mixed in a tube. cDNA at 10 ng/ µl was added to the reaction tube and made upto 50 ul with deionised water. The reaction was run at 94 °C for 6 min, and then 35 cycles of 94 °C for 30 secs, 55 °C for 30 secs, 68 °C for 30 secs, 72 °C for 30 secs followed by 72 °C for 6 mins. Gel Electrophoresis In order to see the purity of the cDNA synthesized (not contaminated with genomic DNA) gel electrophoresis was carried out. 2% Agarose Gel was prepared with TBE and cyber red added as a fluorescent tag. The gel was poured on a gel plate and a comb was inserted and ran for 30mins at 90V. Relative Quantitative PCR In real-time quantification technology the TaqMan MGB probes contain: †¢ A reporter dye (6-FAM) linked to the 5 ´ end of the probe. †¢ A minor groove binder (MGB) that increases the melting temperature (Tm) without increasing probe length (Afonina et al., 1997; Kutyavin et al., 1997); it also allow the design of shorter probes. A nonfluorescent quencher (NFQ) at the 3 ´ end of the probe 5 ´ Nuclease Assay Process A TaqMan probe contains a reporter dye at the 5 ´ end and a quencher dye at the 3 ´ end of the probe. The DNA polymerase cleaves the TaqMan probe during PCR and separates the reporter dye and quencher dye. This cleavage results in increased fluorescence of the reporter dye (26). Figure 3.TaqMan ® probes require a pair of PCR primers in addition to a probe with both a reporter and a quencher dye attached. When the probe is cleaved, the reporter dye is released and generates a fluorescent signal (Invitrogen). The reporter dye does not fluoresce if the probe is intact. During PCR, if the target of interest is present, the probe specifically anneals between the forward and reverse primer sites. On the other hand if the probe hybridizes to the target the DNA polymerase cleaves the probes between the reporter and quencher. The fragmented probes then separate from the target of interest and further polymerisation of the strand continues (26). For quantification of the change in expression of mRNA the ABI 7500 was used to perform the thermal cycling, data collection and data analysis. In a MicroAmp 96 well plate (Applied Biosystem) 10  µl of final volume of TaqMan mix was placed. The mixture included 5 µl of TaqMan Gene Expression Assay, 0.5  µl of the primer, 0.5  µl of GAPDH (endogenous Control) and 4  µl of 1:3 diluted samples. Prior to this study Ct value (cycle threshold) with a standard curve (Fig 5) was constructed and the primer and GAPDH concentration were determined by optimisation studies. All the primers were purchased from applied biosystem and are listed in Table 1. Using the ABI 7500 system the PCR was carried out at 50 °C for 2 min, followed by 95 °C for 10 mins. Then 40 cycles of 95 °C for 15 secs and 60 °C for 60 secs were performed. Mean relative quantification (RQ) was evaluated using the à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct method using GAPDH as endogenous control. Prior to analysis the PCR products were run on a 2% agarose gel to confirm that the templates have amplified along with GAPDH as endogenous control (figure 5). DATA Analysis The data generated from the RT-PCR were analysed using the recommended threshold by Applied Biosystem and then exported in Excel format. For calibration and generation of standard curves several cDNA cell lines were used: cDNA from DU145, LNCaP and C42B. The slope of the standard curve was calculated from the log input of cDNA in ng/ µl versus the corresponding Ct value. Basic statistical analysis was performed in Excel. Results Cell Culture Dr Prowse used a non adherent technique suspension culture and identified a group of cells within the prostate cell lines 22RV1, DU145, PC3, VCaP, LNCaP and C42B that had the ability to form prostasphere (Figure 4a). Furthermore using the clonal growth assay, each prostasphere was able to grow a further 1-3 prostaspheres (5b) when dissociated to single cells (10). These prostasphere along with prostate cell lines were used in this study. Immunoflourescence conducted by Dr Prowse on the prostate cancer spheres derived from single cells are illustrated in Figure 4A. Figure 4. Representation of prostasphere formation, culture and the effect of Wnt3a on Keratin 18, CD44 and ABCG2. A) Prostasphere shows self renewal and proliferation and this is a schematic representation of this process. B) Prostasphere formation with 0.1% DU145, 8% LNCaP and 8% of C42B cell lines. C) Effect of Wnt3a on keratin 18, CD44 and ABCG2 (Bisson and Prowse et al 2009). RNA extraction and RT—PCR Upon RNA extraction of the cells lines and prostospheres the concentrations were measured by spectrophotometer. It was 234ng/ µl for C42B and 190ng/ µl for DU145 respectively. A PCR was conducted with glucocorticoid receptor gene intron primers and gel electrophoresis was carried out to verify the purity of the samples. Only genomic cDNA of LNCaP and Hela cells amplified under 3 mMMg++ conditions (Figure 5). Figure 5. A) Results of quantitative RT-PCR analysis. The PCR in Lanes 1-5 contained 1.5mM Mg++ and lanes 6-10 contained 3mM Mg++. (B) A 2% gel was run with the PCR products that were amplified in Real Time PCR. Lane 1 represented BMI-1, lane 2 NSE, lane 3 ABCG2, lane 4 Nestin, lane 5 K18, lane 6 CD44, lane 7 OCT4, lane 8 PSA, lane and lane 9 sca-1.In all the lanes except lane 8 a double band was observed. The two bands represented GAPDH and the gene of interest. For construction of a standard curve, serial dilutions (1ng/  µl, 5ng/ µl, 20ng/  µl and 50ng/  µl) of cDNA were used. In all cases, there was a strong linear correlation between the number of thermal cycles required to generate a significant fluorescent signal above background and the log of the input cDNA amount (correlation coefficient ≠¥ 0.90) (Figure 6). The Ct value was against the log of the initial template amount and subjected to linear regression analysis. Figure 6. Real time RT-PCR: standard curves for cDNA obtained from LNCaP, C42B and DU145 cell lines at 1ng/ µl, 5  µl, 20  µl and 50  µl . A strong linear correlation between the CT values and the log of the input cDNA amount (correlation coefficients ranging from 0.97 to 1.0) were obtained. Quantification and Comparison of the Real Time Quantitative RTPCR results between Adherent cells untreated Prostasphere and treated Prostasphere. Delta Ct values for adherent cells and their correlation with those for prostasphere treated and untreated samples showed high correlation (r 2 ≠¥90) emerged for all of the tested genes ( Figure 6). GAPDH was used as endogenous control. In order to quantify the gene expression of the prostasphere and treated prostasphere (wnt3a and cyclopamine) to adherent cells (C42B and LNCaP), 10 markers were compared by Q-PCR using GAPDH as endogenous control (Fig 8). The PCR products were resolved on a 2% gel to confirm the templates have amplified along with GAPDH as endogenous control (Figure 5). Duplex product was seen in most of the lanes. The method of calculation was by à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct method. This method calculates the fold change in respect to the normalized gene. In our study we have compared the fold changes of gene expression of the treated and non treated prostosphere relative to the cell line (C42B and LNCaP). In the table (Table 2) we calculated delta delta Ct in relation to the cell line. Each of the samples were run in triplicates, therefore an average of those three were taken in each cases. For example for C42B spheres, the Ct values are 30.19, 29.92, and 30.27. The average of this was taken (30.19, 29.92, 30.27)/3 which is 30.13 and the same was calculated for GAPDH which is 18.94. In each case that is sphere, C42B wnt3a treated, C42B control (dissolved in DMSO) and spheres treated with cyclopamine the average Ct was calculated. Table 2. Example of calculation for quantification of gene expression in fold changes. Sample Average Ct a of samples b Average Ct of GAPDH à ¢Ã‹â€ Ã¢â‚¬  Ct à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct RQ Values d Prostasphere 30.13 18.94 11.19 -2.01 4.04 Prostasphere +Wnt3a 31.20 19.75 11.46 -1.74 3.34 Prostasphere control 33.97 22.7 11.27 -1.93 3.82 Prostasphere+ cyclopamine 30.28 19.43 10.9 -2.35 5.09 Adherent Cells c 13.20 0 1 a.Cycle threshold. b.Prostasphere, Prostasphere+wnt3a, Prostasphere control, Prostasphere +cyclopamine. c. For adherent cells the à ¢Ã‹â€ Ã¢â‚¬  Ct value was calculated from the standard curve. d. Relative quantification or fold changes. à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct was calculated by subtracting the Ct of the endogenous control (GAPDH) from the Cts of the gene of interest eg 30.31-18.94=11.19. Fold changes are calculated relative to the adherent cells. Therefore à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct is calculated by subtracting the à ¢Ã‹â€ Ã¢â‚¬  Ct value of the adherent cells from the à ¢Ã‹â€ Ã¢â‚¬  Ct of the sample i.e.11.19-13.20=-2.01. Relative quantification (RQ) value of gene expression was calculated by the use of the equation RQ= 2-à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct RQ=2-(-2.01) Therefore an RQ or fold change relative to the adherent cells is 4.04. Figure 7. Q-PCR analysis of the mRNA levels of Nestin, Sca-1, Oct4, BMI-1, NSE, K18, PSA, CD44, ABCG2 and c-kit. Expressions of the markers were calculated by employing the ΔΔCt method. (A) Nestin expression was decreased in prostaspheres in C42B adherent cell, prostasphere treated and untreated and were insignificant. (B). Effect of Sca-1 on C42B was unchanged between adherent cells and the prostaspheres. However in LNCaP a modest increase was observed. (C) The prostasphere expressed nearly two fold increase in expression. (D) Oct4 expressed about four fold increase in prostasphere treated samples (Wnt3a and cyclopamine). (E) In LNCaP Oct4 expression is reduced in Wnt 3a treated prostasphere. (F) In C42B prostasphere and Wnt3a treated prostasphere BMI-1 showed slight increase in level of expression. (G) However this change is not as pronounced in LNCaP. (H) NSE marker shows very high expression for C42B prostosphere control and marked reduction when treated with cyclopamine. (I) In LNCaP, no such change was observed between Prostasphere and Wnt3a treated prostasphere. (J and K) Keratin 18 shows extremely high levels in prostasphere with reduction when treated with Wnt3a or cyclopamine. (L and M) PSA failed to show significant changes in the level of expression. Although wnt3a and cyclopamine treated samples showed slight reduction. (N and O) CD44 was not expressed in both C42B and LNCaP prostosphere. However the adherent cells had high expression of the marker. (P) ABCG2 shows high expression of prostasphere in C42B. Wnt3a treated spheres showed reduced levels. (Q) In case of LNCaP extreme level of expression of ABCG2 was observed in prostosphere. (R) c-kit/CD117 was expressed more in the prostasphere with reduced expression on the Wnt3a treated and cyclopamine treated samples. Nestin and CD44 showed significant reduction in expression compared to the adherent cells of C42B. Nestin expressed less than 1% in prostasphere (figure 8A,) and negligible expression of CD44 (figure 7N) in C42B. There is increase in expression of SCA-1, OCT4, BMI-1, K18, ABCG2 and C-KIT (Figure 7 B, C, F, J, K, p, Q and R). NSE showed significant increase (Figure 7 H) in prostasphere control (97% more expression than adherent cells) and 100% increase in expression of K18 prostasphere(Figure J and K) and 100% increase expression of ABCG2 in prostasphere, prostasphere treated with cyclopamine treated and control. Interestingly Wnt3a treated prostasphere showed reduced expression of ABCG2 (Figure 7 P and Q). In LNCaP expression of CD44 is insignificant (0.01%) and PSA expression is reduced by 40% (Figure O and M). In case of LNCaP there was 18% increase in expression of SCA-1, 16% of BMI-1, 50% in NSE, 100% in case of Keratin 18 (Figure 7 C, G, I, and K). A summary of the results are shown in table 3. Table 3. Comparison of fold changes in mRNA expression in 10 selected genes determined by real-time quantitative polymerase chain reaction (RT-qPCR). Discussion Collins et al 2005 (41) in their paper states tumour cells are organised as hierarchy that are responsible for the formation of cancer. They have been able to identify and characterise cancer cell population from prostate tumours that have the ability of cell renewal and regenerate expressing differentiated cell products. Various studies have developed non-adherent sphere culture to characterise cancer cells with stem cell like characteristics. In vitro culture in unattached conditions where cells grow in round balls called spheres is routinely used for enrichment and propagation of stem cells (40). Prostate cancer is a heterogenous disease and to study the prostate cancer cells with stem cell characteristics prostasphere were cultured by Dr Prowse. Previous papers have established stem cell markers namely CD44+, CD133, ABCG2, ÃŽ ±2ÃŽ ²1 integrin, Sca-1 and ÃŽ ²-catenin and PSA can be utilized to identify stem cell population in normal prostate (29,30).However the role of CD117 is yet to be defined in human. Figure 8. The self renewal capacity of cells with stem cell characteristics and the proliferation/differentiation of transit amplifying cells are regulated by WNT signalling. In addition AR activity is the driving force behind proliferation and differentiation of the transit amplifying cell. ÃŽ ²-catenin which is also an effector of WNT signaling can interact with the activity of AR (Bisson and Prowse et al 2009). In the paper by Bisson and Prowse (10), the authors provide evidence that in absence of AR, WNT activity can control the cell renewal capacity of the prostate cancer cells with stem cell characteristics. On basis of their conclusion they suggested a model (figure 2) where the balance of WNT and AR activity not only regulates the self renewal of prostate cancer cells with stem cell characteristics but also the proliferation and or differentiation of the transit amplifying cells. In my study I tried to characterise the stem cell population within the prostate using different stem cell and differentiation markers and measuring their relative gene expression. This evidence can be used to further charaterise tumour stem cells: as they may comprise only a fraction of the cells responsible for the tumour, and have the abilities of self renewal, proliferation and differentiation. Nestin a neuronal marker, is an intermediate filament protein that identifies progenitor cells in adult tissues. Previous papers (31) have provided evidence of detectable levels of Nestin mRNA and these levels were increased in case androgen-insensitive prostate cancer cell lines (DU145). They were undetectable in the androgen dependent cell line LNCaP. While in C42B, Nestin was expressed only in the adherent cells (Fig 8a). Embryonic stem cell marker such as Sca-1 are used to enrich properties such as, replication quiescence, androgen independence, multilineage differentiation and is capable of promoting regenerative capacity of prostate; in short characteristics of stem cells. In consistent with recent reports (32) our study indicated LNCaP cells grown in anchorage independent conditions showed increase in expression of Sca-1 (Figure 8c). Similarly Oct-4 responsible for stem cell self-renewal (33, 34) showed increase expression in C42B prostasphere (figure 8d). NSE is one of the prognostic indicators of aggressive androgen-independent prostate disease. Neuroendocrine cells provide growth and survival signals to surrounding tumour cells and thereby results in an increase in stem cell population (35, 38, 39). Gene expression is significantly increased in LNCaP prostasphere (Figue 8i). This maybe due to acquisition of the neuroendocrine characteristics by LNCaP in response to long-term androgen ablation therapy (35) or the selective differentiation of prostate cancer stem cells into neuroendcrine cells by non-adherent culture. A recent paper (10) investigated the role of WNT on the size and the self renewal capacity of the prostasphere. The authors noted a significant increase of keratin 18 and CD44 expression with the addition of Wnt3a. This increase in expression was detected in adherent and non adherent cultures with LNCaP prostasphere exhibiting slightly higher level than C42B. CD44 is an important marker with a distinct role in migration and signalling and is present in both stem and differentiating cell population. Evidences have been provided that show CD44 to be present in tumour–initiating cells (36, 37). Therefore it is probable the CD44 would exhibit high exp